Summary
Transcript IDgene_000008992
Gene IDTTHERM_00051700
Length3772 bp
Sequence
AGAAAATTCATAAAAAACACCAAATTTATTTGGAAAGAAAACTGAAGAGTGTTATAAAAAAATTTGGAGAGAGATTTAATTTAGTGAAGAATATAAAAGGTTATTGATAGCTCTAAATGGATAAGGGAGGTTGTGGTGATTAGAAGAATATATTAATTGTATTACACGGGGATTTAAAAATAAATAACTAGAAAAACCTTAGTGATGGTCATCAAAATAATGCCAGCACTGGTAATAGTAATATTGGGGTGGTGGAAGAGAAGACAAGCGAAGATCTTTAGCAACAACAACAACAACAACAAATACAACTTCAAACATTAACAACATTATCAACAATTACTTCATCTTAATTATCGGAATTATGCTGGGAGGTTTTTGATCTGCAAAACAAAAAAAGTCTTACGGATGTTCAATCTATCAAGCAGGAAGATTTTAATTTGTAGAGTATTTAAAGCTATATTCAAGATATTTCTTAAGACCCTACAATATAAATTTCATTTTTAATTTCTGATTCATAACTTTATTCTGTTTTGTAAGGGATGAGTAATTTGAACTGGATTTACAAATATGAGATATTTGACATCTTACATTAAGCAGAGTTAATATTTTCTGATAAAAAAGATTCCATAAAAGACTTGATTAATTACTTCTCATTTTAGAATGATTAGTAAACAGCTTAAAAATCTGAAACTTTTTAGACAGCTACGTTAATATCTAAAATTGTCTCTATTATGCTCAGGACAACTATCCCTTTCAAAGATCCACTGAATTAAGAAATTTTGAAATTAAAGAATCAGAACCTGACTTCTAAGATGGAAAACAAAGAATCTTAAAAAAATATTTTATAAAGTCCTTAATTAAAAATTATAAGATAGTCAAGTGAAAGCTCAAATTAGAGACAAATTATAGATAAAGAAGAGCTATGGAGTGATCCAAAAGGCTTGCTTATTAATGGTGGTTCACATTATTTCTTGAAACTTAGAGGGATACCTTATAATGCAAAAGAGTCAGAAGTTTAAGACTTTTTAGGTTTAACATTAGACAAGTATCAAATGGTTTTTAAATATGATAAAAATGAAAAATTTACAGGAGAATGCTTTATTAAAGCAAAGGATCAAGATCAATTTGATAAAATAAAAAGTATGCATAAAAAAACTATGAAAAATAGGTATATTGAGATATTTGTAGCTGATAAAATTGAATTTGTTTAAGCTTAAGAATCATAAAATATGAATGATAGTAACTTTTACTTAACTGAAAAAGGTAATTCATCTAACTTAGGGCATGGATTAGGACAACTAATTACATCCTCAAGTAAGAAAGAAAGTGATAATTAGATTAAAGATAGAAAGAAGGCATCTAGAAGAGATGTATCGAGAAGTAGAAGCTCCAGAAGTAAAGAAAAGACTTCTAAAAGTAGCAGCAGAAAATCTAATAGCTTTTCCTCATCTTCTTCATAATCATCATCTTCACATATTAGGACTTAAGACAGCTAAAGTGATAGTAAATATTCTAAGTCTGGTAGTAGAAGTGATTCTTATCATTATCTAAGGCTAAGGGGACTTCCCTTCAATGCCAGAGAAGCTGAAATCTAATAATTTTTAGGAATAAGTTTAGAATAAGATTAAATTACTTTTAAGCATGACAATGATGGCAGATTTAGTGGTGAGTGTGTCATTAGAACTAAGGATCAAAACTAACTAGACAAAATAAAAGATAAGCACATGAGAAATATGGGTAAGAGGTATATTGAAGTATTTGTTGCTGAATAAAGTGATTTTGTTCGTGCTTAAGATTCTCAAATTATTGATGATTAAAAAGTTGGTATATCCTAAATTAATTCACAAATAGACCCAAATCTTCTTTAGAGTGCAAACATTGTTAAAATAAGAGGTTTACCATATAATGCAACGGACTAAGATATCTAAAAATTCTTCAAAGATTCACAAATTGTTCAAAATGGTATTTAAAAAGTCTATGATGGAAAAAGACCTTCAGGTGAGGCTTTTATTATATTTGCTACAAAGCAGGATGCTCAAAAAGCTATAGAAAAAGATAAAGAAAAAATGGGCAGTCGTTATATTGAAATATTTTTGAGTCACTTAAAAGAATTTACTAACCACATAAAAAAGAGAAAATCCTACTCTGGAAGCAATGGCAATTCGAACGGAGGCTCAAGCTCTTCTAATTCATCTAATAAGTTTTCAAATCACGGAAATAACGGAAATCGCTACGATAAACATTCTAACAGCTCAGGGGGATTTTCAAATCATAATAATCATGGAAGAAATAATAATAACGAAGGCAGGTTCAATAACCATCACTCTAGATACAGTAACTCACCTCACCGTAATTATGGTAACAACGGAAATAACCATAATAACTCCTAAAACGGATCAGGTTTTTATAAAAAAGGAAATGGATAGACAAATGGAAATTATGATCGTAACGCAAAAGGTTTTTAGGAAAATTAGTATTCATCTAAATTTTCAAATAATGAAGAGAAATTTAGCAACATGAATCATAGCAGCAGCAGTAGTAGTAAAGGATACTCGAATAACTACAATAATAATTAAAATTAAATGCATAGTAATAATGGTAACGGTAATCATAATTATGGAAACAGAAATAATAGCAATTATTAAAACGATTTTAGTAGAAATTTTAAAAACAAAGGGAAGGAAGACTAAGGAAAATACAGTGGAAGCAATAAGTAATATGATAATAACTAATTTAATTAATCTTAATAACACAATTAATATTAACACCAATCTTAGTCAAACCATAACTAGCAACAATAGCCTTACAGTAAGAATTAAGGAGGACCTTAAACTTAAAATGATGGTAATTATTATGGAGGAAATTATGATTACCAATACTAAAATTAATAATAAAATAATTCTTAATAAATGAATTAACATTAATCTTCATCTGGATACCATTAAGAAAACAATTAGCTTAACAAAAATTATAATAATAACTCAAATGAAAATTAATAATATTCTCACCATCAACCTAGCTAATAGTAAAGCTACTATAATAATAACTCTAATTCAGGCTAATATCATTAATAATAATAGTAGTATTAAAATTAATAGTATAACTAAAATAACTCTTTTGATCCTTAGCATCAACCAATTAATTATAGTTAGTATAGCAATTAAAATAACCATAATTAATAGAATTATCCTCCTAACAACTACTACGGTTAAAATTAACAAGATCACCATTCATAGTAGCAGAATCATTTAAACATAGGTTAATAAGGTCATCCTTTAAATACGAATGGATCTCAAAACTCTCAACCATAATACTACCAACAAAATATGTTTGACATTCAACACCAACAACAATAATAGCAATATCGCTATTACTGATCAAATTATTTTTATATTTTTAGTAAAAAACAAAAATTAAATAAACAAAAATCTAGTTTAAGAACAAAAACTTTTCATTTCGAAATTTTATAAATAAAACATTCAAAAAATAAACAGCTTTCTTTTTAAAAATATAAAATACCCATAGAAACAAACAAAATATACTTTAAATTTTGCTTTATATTCCTTGCAAAAAAATCCTAAAAATGAATTTATAATAGTTAAATAAATAAATGGTGCTAAATGATATTTTTGTATCTAAAATTTTTATAATAAAAATATATAAAATAGTAGTTAAAATATGCTAAAAGGGCTGTTAAAAAATAAATTATAGTTTTATATTTAATAATTTTACTGTTTAATAACACACTTATTTATATTATATATTAGTATTC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1511.4 L-2466.6 L-3653.9 S-01,460.8 S-3882.1
S-6703.8 S-9817.9 S-12905.6 S-15841.8 S-241,213.4
C-0469.5 C-23,392.5 C-43,227.5 C-63,498.9 C-82,200.9
C-101,698.0 C-121,347.5 C-141,179.5 C-16997.3 C-18825.3