Summary
Transcript IDgene_000009013
Gene IDTTHERM_00052130
Length934 bp
Sequence
AAAATTATTAAAAACTTTAACTCATAATATATAAAAAGAAAAGAAAGCAGATGCTAAACAGGGTCTTAAGAAAGTTCTTCTCATCTGGTGTGGAGAGATAATGCACAATTTCATATCTTGATGGTAAAAACTAAGGAGTTGCATTAGTTGAACTCAATAACCCTTCCAAGAGAAATGCATTATCAAATAAGCTTGTTGCTGATTTAAAGGAAATTATCCATGAATTAAATTCAAACTCCAATATTAGAGTTGGTATTTTGAGAAGCAAAACACCTGGAATGTTCTGTGCAGGTGCAGACTTAAAAGAAAGACTCGGTTTATCAAACTTCTAAACTGAACTTTTGGTTGAAAATTTAAGAAACACTTTTGATGCATTATACCGCGTTCCCGTTCCTATGATAGCTGCTATTGATGGTCCTGCTCTTGGAGGTGGTTTAGAAATGGCTATATCATGTGATATTAGAATTGCAACAAAGAAGAGTTTACTTGGCTTACCTGAAACTGCCTTAGCTATAATTCCAGGAGCTGGTGGTACTTAAAAATTACCAAGATTAATTGGAGTAGCAAAAGCTAAAGAACTTATTTTTACTGCTGCTAAATTATCACCTTAAGAGGCTTTAGAATTAGGAATCTTGAATTATGTAGAAGAAGATTATGATTCTGCTTATAACAAAGCTTTAACAATTGCTGAGTTAATTCTTAAAAACGGTCCTATTGGAGTACGTGCTGCAAAGGCTGCTATTAATTTAGGAAGTGAAGTTGATTTAAAAACAGGTTTAGAAATTGAAAAAATGCAGTACACAAAAGTAGCAAACAGTGAAGATAGAATTGAAGGTCTTAAGGCTTTCGCTGAAAAGAGATCTCCTGTTTACAAAGGAATTTGATATATTTTATGTGTAATTTGTTATACTTTTTTAAAAATTATCTGTTAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,369.4 L-25,556.2 L-34,463.0 S-01,912.4 S-3161.6
S-6239.4 S-9336.9 S-12523.4 S-15455.8 S-24312.9
C-0404.4 C-21,211.9 C-4462.6 C-6228.8 C-8294.7
C-10511.2 C-12517.2 C-14460.6 C-16345.1 C-18255.3