Summary
Transcript IDgene_000009052
Gene IDTTHERM_01142760
Length710 bp
Sequence
TATTTCTAAATTCAACTTAATAGCAAGTAAAATCAAGAATATTAAAATGAGCTCTGGAGATCTTCCATCTGCAACCTTAAGCATGATTTAATAAGGTCAAGACCCCAAAGAATTGGTCCTTTAACATTGCAAACCTAACTGTCTTCACTGGGAATAAAAACTTAAGAGATGTGAAGCAAAGTTAAGAGAACTTGTTAATGCTGATCCTGAAATGTCATGCATGTATCCTCTTAGAGATTGGGTTACTTGTGTTGAAGCTTGCGTTTAACCTCAAATTATTTCTTAACTTGTTGGTGCTTAGAAGGGAAGAATTTGGTGAAATATAAAAACATCAATTTTTAACTTTAAAATGAGGCATATGTCATATTATTAGCTAAGAAGATAAATTATTTGCTTGAAATTACATAACTGAGAAGTATTTATTGAATTATAATCAGTTTATCTTCTCAAAAGATGATTATTAGTAATAAATGCCTTTAATCAAGTGATCTTTAAAGGAATAAAGAATGAGTATTCAGATTAATTACTTACTAAATTAATATTTTCAAATATAACTATTTGCTAATAATTATTGTTATGTACTTGAATGATTTATGATAATATGGTGTCTGTCCATCGAGTATAAAAATTTACATAATAATTTAACTAAATTCTCCATTGTAATTTTAATAACTTACTCTTCAAAACCTTTTTCGTATTTTATATTTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,614.2 L-26,916.9 L-36,995.4 S-02,968.5 S-31,065.2
S-6694.0 S-9535.9 S-12658.5 S-15665.0 S-24497.1
C-0381.3 C-2284.9 C-41,045.8 C-6737.6 C-8432.6
C-10677.0 C-12619.6 C-14627.8 C-16384.8 C-18450.1