Summary
Transcript IDgene_000009098
Gene IDTTHERM_00028470
Length2239 bp
Sequence
TCTATACTTAAAATTAGAATAGCAATAATTTGCAAGATAAATAGGTAGGACTAAATAAAAATGAGATCTTTTAAGTTGTTTATTTTAGTTTCCTTAGCTATTTTCGTTTTAATGAGTAGCTCTAGGTAAGTGAATGCTGAACTTGTAACCATAACATAGTTTAGTGATATAGCTGATAAAGTAAGAAGCAATCCTAATTCTTTATCTGCGATTATGGTAACTCGTTTAAATTAATGTGAAAGATGCAATGTCGGTGTTAAAGTTTTCAAAGAATATGCTGCTTTAGTTGATGGAGTTGTTCTTACTTATTTAGTAGATTGTGAAAAAGTCTGGGAAAACTTTGAAGACCAACCAAGAATTCCTGCATGTGACCCTGAAAAGAAAGATTAATTACCTCATATTACTTTCTTCTAACCAGAATCTGATGAATTAGACATCTATAATAAGAAAAATAAAAAACTACCTAAAGATGTGCCCTATTAAGGTATGGTTAGTCCGGATGCTTTAATGCAAAAGTCAAAAGAATTGCTTCCTTCTTTTATTAAGACTATTTCTAATCCCAAGGACATTGACAACTATTTAAACTTTAAAGAAATCCCATTAAAGTTAGTTCTTTTCACAGATGAGGAATAACCACCTCTATTTTTACGTGCCTTAAGTGGACAATATCGTGGCTAAGTTGATTTTGGTTTAGCTGATGTTGACAATAGAAAGCTTAAAAAAAGATATAATGTTTCAAATTTCCCACTTCTTATAGCATTAAAATTATCAGGCACTGATTATGAAAGGGCCGATTTCAGTGGTGAATTTACTGTCCCAGCTGTTGCTTCTTTCATTTAAGAATAACTTAAATCTATGCAAGTTGACAAACAAAACACCAAATAAAATTAAGGAACATACTTTGATATTCCCGAAAATGTAGATGTCCAAGAGTTAAAACCAGGCTAAATTCTTGCAGCATTGAAGAAATATAAAGAAAATTTCGTAGCCTTCCATCTTTAGAAAGGAAAATCTTCTGAAACTGCTTAGATTTTTGACTAGCTTAAATAAGATTTCGGCAACATGTTTAAGTATTACTAAGTTCAATGTAATGCTGAATGCAATGAAATTTTTGGTAGTAGCTTATCAACCTATCCAGCTGTGATAATTTACCCATTAAGTGGAACTAGAAATTAACAATAATTTGTTAAAGTTAACAAATATGATGACAAAAATGATTTATCTTCAGAAATTCTAAACTCCGTTTTATACAGCAATTTAGTTGAAAGTGAAGTGGAAAATGATTAAGATGCAAGAAAGAAAATAAGAGAAGGGCTTGATGGTAAAAAGTATTCTGTAATTTTAGCTCATGATAAATATGACCACTATCAAAAATTGATCTTCTTTATAGTAACATAGCAATAGCGTTTCCGTAAATACTTGAATTTCGTTCGTTATGTTAATCCAACTTAAAGTGAAATTAAAAATTGGAGCTTAAATGGTGTTCCTGGAATCGTAGCTGTTTTAGAACTAAATGACTTTTAAAACACTTTTAGAAGATCTCCTTATGAATAAAAGGACTTCTAGTTTAAATCTGTAGTTGATTATTTAAACTAAATTGCCATTTAAAAGCAAGATGAAGTAGTTGACCAAATAAAGGTTGAAGAAATTAAAAAATAAGAAGAACTTGAGGAGAAATGTCTTCTAAATACTGAGAAGCCTTGCTTAATTGCTCTTTTCGATATGTCAAAGGAAGGTAAATTTAAGTTAGACTTAGAGAAGATTAACAAGATTAAGAAGCTTTATGCAGATAGAGATATTGGTTATTTCTATATTGATGCTAAATGCCACAGAGAGCTTTTATAATACTTTAAAATTCATGATACAAATCTTAACAGCTTAGTTTACTTAGACTAAAAGAAAACTAAGTATAGATTACTTAAGGAAGCTTTTGAACTTGAAAATCTTATCAGCTTTATGGATGACTTATAAGGCAAGAAACCTAAAGGATTAGTAGCCTTACCAGGTTCAATAGATTTGGATGAAAGAGATTGTGATGCCTTTAATGCAAGTGAAAAACAAAGATTAGAATAAGAAAGACTTCAAAAGAGCAAAAGCAAATATAAAAAAGATGAGCTTTGAAAAAAATTTTAAATTAAATATTTTAATTTGTATTTGTATTTATTTTAAACTCTTTTTTTATAGAAATAACTAATTTTGTTTGTATTTTTCAATATAAAGCTCCTTAACAATAATTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,593.2 L-26,793.4 L-35,684.4 S-017,194.2 S-39,376.7
S-66,631.4 S-95,250.2 S-125,107.8 S-155,802.5 S-245,664.9
C-06,969.0 C-23,864.3 C-42,108.9 C-62,398.3 C-85,765.3
C-106,026.4 C-129,168.9 C-144,485.2 C-165,252.0 C-184,142.1