Summary
Transcript IDgene_000009127
Gene IDTTHERM_00030190
Length1228 bp
Sequence
AAAAATAAATAATAAAATAAAAAAAAATAAATAAATACCCTAAAACTTTAAAAAATGATCTCTAAGCTCTTCTAAAATACTGCTAAGTCCCTCACTGCTGTCAACAGCGCTTCCTTCAGTCACCACCACCACAAGGCTCCCGTCAGAGTTGCTGTCACTGGTGCTGCTGGTAACATCGGTTATGCTCTCGTCTTCAGAATTGCTTCTGGTGAATTATTAGGTAAGGACCAACCCGTCATCCTTTAATTAATCGAACTCCCCCATGCTTAAAATGCTCTTAAGGGTGTTGCTATGGAATTGAACGATTGTGCTTTCCCCTTGTTACGTGACATCGTCACCACTGACAGCCAATCTGTTGGTTTCAAGAATGCTGACTACGCTTTGTTGGTTGGTTCTAAGCCCAGAGGTAAAGGTCAAGAAAGAGCTGATCTTATCAAGGATAATGGTAAGATTTTCGTCGACACTGGTAAGGCTATTAACGACAATGCCTCCAGAGACTGCAAGGTTTTGGTTGTTGGTAACCCCGCTAACACTAACTGTTTAATCGCTGCTCACTATGCTAAGGATATCCCTAAAGAAAACTTCACTGCCATGACCAGATTAGATCACGACCGTGCCTTATACTAACTCGCCTCCAAGACTGGATCTTAAGTCACTGACATTAAAAAGCTCTGCATCTGGGGTAACCACTCTCCTACCATGTATCCCGATTTGACCAACACCACCGTTCACAATAAGCTTGTTGCTCCCACTTTGGACCATGCTTGGATTGATACTTTCTTCAATCCTAAGGTTGGTAAGAGAGGTGCTGAAATTATTGATGCCAGAGGTTCTTCTTCTGCTGCTTCTGCTGCCAACGCTGCTATTAACCACGTTAGAGACTGGGCTTTGGGTAGTGAAGATTGGGTTTCTATGGGTGTTCCCTCTGATGGTTCTTACAACGTTCCCAAGGGTTTGGTCTTCTCCTTCCCCGTCACCACCAAGAACGGTAAGTACTCCATCGTTCAAGGTCTTAAGATTAGTGAATACTCTCAAAAGAAGATTGATATCACTACTAAGGAACTTCTTGAAGAAAGAGCTTGCGTTGAACACTTACTCAAGTGAAAAAATAAATGCATATAAATATAAATTTCTAAAATCAACACTTTTGAAAAACTGTATATCAACTCTTTTTATGTGAGATATATATTTTGTTCAAAGGCTTAAGATTATTCTACTTTTATTAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-149,400.2 L-256,491.8 L-358,910.9 S-047,802.2 S-334,751.3
S-612,069.6 S-916,339.2 S-1217,340.6 S-1514,890.9 S-245,314.2
C-03,430.3 C-22,770.8 C-44,324.8 C-62,681.8 C-812,322.4
C-1011,922.0 C-129,612.2 C-148,589.0 C-168,407.0 C-187,150.4