Summary
Transcript IDgene_000009135
Gene IDTTHERM_00030370
Length1381 bp
Sequence
AGAAAAGTAAGCATGCTTGAAATCCTTCAATGCCTTTTGCAAGTTGGATTGATTTATATGCAATTCTTATGTGATTCAAAGAAGAATTGCTCATCTGAATAAAAAAAATCTCAAGCATATTTGATTTTATTTATACTTTTGGTAACAATAGTAAAAACAAAAATAGAAGGAAATAGATGGATGTTTATAATATGGCTTCCCTCCTTTATTTTAAGCATTTTTCACAAAATATTCCATACATACACTTAAGTTGAGGTTGTTTACATTTCAGCTTTGCTATCTACACTTTATATTCTTTTGATGATTTGCTTTCCTATCTATGAAATACCATAAGTAATCGATTAGACTGAGTAATCTGAAAAATACCCTAAATACAATGTATCTTGTGCAAGCTTTCCAATTGACTAGCAAAAATCTTCCATGATTACAGCATATTATCCTACTAGTCCTGAAAAAAGTAATTCAGAAAGTTCTGAGGGAGATCTATGTATGCTTGAGTCAGATTTTTGGGACTATCATTATTCTTCTATTTTTAAGCAATATAAAGTACCAGGATTTATATTAGATATTGCCCTTTCTGGCTTAAAAAAATATAAAGTCAAAGTAGAAGCTAATCTTCCAGTTATTTAAAAAACTAATTTAAAGCCAATTATTTTTTCACATGGATTTATGGGATCTCGAACTATGTATTCTATTATTATGAAATAACTAGCTTCTTTAGGGTATGTGGTTTTCTGTGTAGAACATTATGATGTGATTAAAGAAAAGGAAGTTGAAAAAATAAAAGATAAAGTTCTGAGGAAAAATCTATTTAAAGAAGTAAAAGAGCAAGAACTAGAAGCAAGAGCATCAAAAATTAAAAGCATGATAGATCTTATTTAAGATGAAAAAGAATTAAACAGGTTATTTAAATAGAATTTAAGTTTAGATAAAAATAACATAACTTTAATGGGGCATTCGTATGGAGGAGCCACAGTATAATGCTCCGCTTTTAAATATACAGAGCATGTAAAAGCTTTAGTCTGTTTAGATCCTTGGCTTTTCCCCATGAAAGACTCCTATTTAGAATAAAAACTTAATATACCAGTATTATATATAAATTCAGAATCATTTAATAAGACTATGCTTTGGGCTGAGATAGATTAAAGAAATTAGAAAATATTTTAAAATTGTCAATAAAAAGAAAAAAGCTTGATCTGTTATGTTAAAGATATGGATCATATTCAATAAGGTGATATAGGTTTAGCTATTCCATATGAAGCAAAGATAGTTAATTTAATTAGATATCCACTTAGGACATTAGAATTCAATTTGTACAATGCAAAATTAATAGAACTATTTTTAAATAATATAGCTTTTTCAAATCAAAAGCCAGAAGCAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1649.0 L-2550.6 L-3383.9 S-0244.2 S-3552.6
S-6496.9 S-9511.8 S-12502.5 S-15462.0 S-24474.8
C-0590.7 C-21,669.6 C-41,433.2 C-61,384.0 C-81,053.5
C-10396.4 C-12236.8 C-14325.2 C-16380.2 C-18390.6