Summary
Transcript IDgene_000009169
Gene IDTTHERM_00035540
Length3215 bp
Sequence
AAGAAGAAACATTAGAATATTTTATAAATTTAGAATTAAACATATCAATAATACATAGGGACATACATTAATAACAGCAAATTCTTAATATTTAGAGACATTTGTATTTAGTATAAAAAGATGGAATAGTCGTTGCTTAATAAATAAGAAAAGTAGTAGTCTTAACCAAGAAAAAAAAAATAAGTATTTTGCTGTTGTTTTGGCGGAGGAGACGATGTAGAAACTGATGAAGAATAACATCATCAAGAAAAGTAGTAGTCTTAACCAAGAAAAAAAAAATAAGTATTTTGCTGTTGTTTTGGCGGAGGAGACGATGTAGAAACTGATGAAGAATAACATCATCAAGAAAAGTAGTAGTCTTAACCAAGAAAAAAAAAATAAGTATTTTGCTGTTGTTTTGGCGGAGGAGACGATGTAGAAACTGATGAAGAATAACATCATCATTAAGGTTAATAAGAACCTAATTATTTTTAGCAAAATAGTTAGGATGTAAATAATACAACAACAATTCCTTGTATGAGTAATATTTCATAGCCAAATAGCGAAATCTATACAAGTTAAGGTTACGCTTAATAAAGTAAAGCTAAAAACTCTCCACAAAAAGAAAGAAAGAGAGATATGCAATCTTCTTCTCATAACAGCCGCGTGATAAAAGAGTAAGGGGAAGAAAATAATAGCAGCAGTTCAAGTAATTCCACAAATAATTAATAATAAAATTACCAAAAGTCTTAAAATTAGAACATAAATGAGTATAATACCCCTAATCCATAGTAAAATGCTATGAGTAAAAATACGTTAAAAATATAATCTCATAAAAAATCCACAGAGTAATCATATACAAATGAGCATGATACTTATTTGAATTTCGATTAGAGCAGCCAAGCATTAAATGCAGATTTAAACCATTCTTTGTAAAGCAAAAATAATCTCAAAAACTCAGTTAAGAAAGCTAAGTACAATATAAAAGCGTTTTTGTAATAATACAAGCAGCAATAAACTGATCTTTTCCATCTGTATTGTAAAAAGAAAGAAAGCTATTTATTAGTCAAAACCTTGGAAAAGAATTTCTAGAGTAACTCATTCTTGAATTCTCAGGTAAATCAAAACCCCAGCAAGCAAAGTATCTGCTAAAAAGGAGTAGTTTCTACTGATCCAAATAGTTACTTTTACAACAGAAATTTCAAAAGTGATTTTGACAGCTAATTTAATGCAATTCCTGAGCCGATTTGCTAATATCTTTCATCTAGATTAAAAAATCAAATTGTTGTAGACGCCTTTTGTGGAGTAGGTTACAATACAGTCTAATTTGCTAAAGAAGCTAGCTAAGTGATTGCTATTGATTGCAATTAGGTTAAAGTAAGCCATGCTAAATACAATATTGAATCATTCAAATAACAGCATAAAGTTGAAGTAATTTAATCTGATTTCCTTCAAATGAAAAAGTTGAAAGCGGATACAGTAGTTCTTCATCCTGACTACAAAAAATTTGATAACTCAATTTCTTCTTCCTAAGGTATTGATAATTCAATTAACCTACTTACAGAAGTATAGCCAAATCTCGTAGAAGCTCTTAAACTCTCATTTAAAATTTCAGACAGTGTTGTAATCATACTTTAAAAAAGTTGTGATATCCAACAGCTCCCTCAAGTATTAGAGCAAGCTAATTATCCATATAAAAAATTCGCTGTTGAAATCGAACTAATGCATATTGACAGAAAATTCAACCTTGCTCTCGTTTTTCTTGGAGATATTGCCCAAGTAAGCAAGGAAGAAGTTGTAGAGTATTATACAAAATTATTATACGAAAGTTCAGATGTTTAAAATTAAATATTCATGAACAAGATCAAGAGTATTCTAGTGCATATAATGCATACAAGTAAAATCAAAGGAGTTTCTTAGTTAATCGAAAATTGTGAAAAATCTGTAGCCTCTCAGCAAAACAGAAAAACTTTATTCCAAGAGTTTTATGATTGCTTAAGTGAAAAAAAAGGAAGGATCAGAAGCAGTGGTAATTTACAGTTCGAAGCTGATAGTATAGTAACTACTGATAAATCACTAAAGCAACTTATAAGAGATATTGACGATATATTATCCGCTAATTAAAAAAGTAACTTTAAATCTTAAAGTCCTTCTAGTAATGAAGACTTAGGAAGTTACAATTACAAGTTTGATTTTGAAGGAAGTAATAAGTTTAATGGAAAGCCTAAAAAAAAGGCTTAATTTAACTAAAGTATGCAAGAAACAGCCCATGATAATTCTAGTAGCTAATCTCTTATTAAAAGTGCACTTACCAAGAAATAAGTAAAGGGGTTAAATAAGAACACTGTCCAACAATTGAAAAAAAGTGAGCAAAATAATAGTATAATGAGTAAAGGATTTAAAAATAGTGATTTAAGTAATAATAATTAAAATGCAGGAAACAATTAAAATAATTAAAGTGAAGATAATCTTAGCGAAAATCATAACGAATATGAATACCATACTAGTCAATATAATGATGAAGACTATGGAGACAGCATTCCTAAAATTATTTATTCTTGCTCCTACGAAACAAACTAATTAATTGATTCAGAGGGTAGTGAAAATAACAGTTTGCGTCCTCAATTCAGTAATGGAATCTACTTCAACTAATCTACTGATGTTTACGATGAATAGGAATTCAGAGCAAGCATAATGAATTTAAAAGGCGGTAGCAACTACTATGATCGCCCATTAGTAAAACACACTAACTCGGCTGGTGGAATATTAGGCTTTACAAGAGAGTAGTTCCTTAATGCAAGCATTTAAACTAATGGATCAGGAAAAGGTCAAACGATTTTAATAGGAACAAAAAGCCAAAAAAATAATGAAAGCAAAAATAATTTATCAGGATATGATGATAACATGAGTAACAATAGATCTGCATCAAAATTAAATTAATATTATTAGCAAGATTTTTAAGAAGACTGTGCTGAGTTTGACTGGTAATAAGAAGAAGGTACAGAAAATAGCTTTTAACAATAACCTAAATAGACATAGACAAAAATAAAAAATAATATCAATACTTTTTAGAATAACCCTGACCTAGATGAGTCATATAAGAATACCAAAATATAAACTGTCCCAAATAGTTTATCTTGATTGTAGCAAAATTAATTTCTAAGTCTTATAAAACTAACTATTTGAATTTAAAAAACATGAAATAATTTATATTATTATTAATGAGAAATAATTAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1726.0 L-2867.2 L-3921.1 S-0750.4 S-3999.5
S-6652.4 S-9860.7 S-12840.5 S-15747.4 S-241,039.5
C-01,190.3 C-22,387.3 C-42,291.8 C-62,141.8 C-81,595.6
C-101,292.0 C-121,167.3 C-14958.5 C-16939.3 C-181,174.9