Summary
Transcript IDgene_000009336
Gene IDTTHERM_00075610
Length2467 bp
Sequence
GAAGCTTAAATCATAAGTACTTAGATTAATAGATAGAATTTAAAATAATAAAGAAATTCAGCGAAATTTTCTTGCATATTTAAGAAAGAATGATTAAATTAGCTTAATAGATGAAGAATGCCAACAAAAATATGATGATAGAAGAAGAGGAAGAGTCTATTTAGCATTCAAACAGCAGTGCAAATAGTTAAATGAATGAATAGTTAGCTTAAATCAGCAAAAGCGTTGAACTGTATTCTGTTAACTAAAACCATTTGAATGATTACAACAATACATTAAGTTTTTCTGATTTAAATAATTCCCTCCGCTTGCAACATTCGCATGAAGGGATAAGCAATGAAACTCCTTTTTAGCAAAAAGCATTTAACAAACAATCTAACTTAAAGAAAAGCAAAAAAGGGATTTTAGGAGTATTTGAGAATTAATCTTATTAAAATAGCGAGTGTTCGAGTACCTTAAAGCTATAGAAATTTAAAAGTTTTTGGCATATTAGATTTTCTAAAGATTATTAGGAAATACTAAAACAAAATCTGAATGATGAAAACTGCTTAGTTTATGTCTGCGAACCTTAATTTTATAATAGTCATATTAAATTAAGGGTACTTCTTTAACCATAATAAGGCGTTTTTAGTGGAGCAACTATTAGAATTTATTTCATAGTAACGAAAGACTACCCTTATAAACCTGTTTTAGCATTTGCAGAAGAGTATATTTATCATCCTAATATAAACAATAACACAAAGCAAATATATTGGAAAATACTTGATGACAGAGAATGGAAACCAACATTGACATTGTATTTCATTATTCTTTAGCTTAAATTTGCATTCATAGAACCTGATCTTACTTTTGTTCCTAATAATATTGAGAATGTGCAATGTGCAGAGCTCTTTCAATGCAACCAATAAGAATTTAGAAGAAAATTTTTAATTTTCTATCAGTCAAATGACACTAGTTCTTTGGAAAAAGATTTATCTAATAAGATGAACCTAGAAGAAAATCATATCGAGGACTCTGAAAGAGAATTCGGAACATTAAACCAATTAGATTATCAATGCAAACCTAGCCATGTTATATAAAATAATATACCAAGGACATTCCAAAATTAGAATCATTTTCCAAATTAACAAAATTAGCATTAATAATTTACAAGCTTAAAAAGTTAAAATATTTTTCATGGTTTTTAAAATATTGACTAACATTTGAATGCCGATAGCTTTGAAAGCAATTTAAAAATATTTGATCCTTCTTCTGCATAAATTTTCCAGAATATAAATTATAATGGTGGAAGTAGCACTTTGAATAAAAATAATCCTTTCTAATCCAGCAATTTCGAAAACATAAACTAATAATAAGAAGGAGATATGAATTATAACTAAAATTTCAACTACTTTCAGCCATAGCCTTAAATAAGCAATTTTGATAACCAAACAAATAAGAATATACTAGATGCTGAATATAATAACTTTGAAAATCACTTAAATATTGCATTTTAAAAGAATTAAACAAATTAAAATTACAATTTTTTCAATAACAATTTAATGAATTTTAACAACAACAACAACAACAACAACAATAATAACAACAATACCAACAACTATATGAATAGTTACTGCTCTTCAATTTCTTCTGCTTCTTCATCAGCCTCTGTAGAATAAGAAAATCAATAAAAAATGGAAGATGAAGCCAATAACTTTAAACAAAGCTCATTCAACAAACTTCACATTTTAACAAGACACCTTTCCTTGGGTCAAAATAGTAGATCCCAAAACAATGAAACAGCTTTAACTCCAACATTAAGAAGTGATAGAGATCATTCCATTAGAAATTAATTTATAAGAGGATCTAATGAGCCTCTAGCAGAAGACTAAGAAGAAGTCTTATTATCAGGAGATTCTAGCAACAACCAATCTAATTACCTTCTAATACAAAATCCTTTCGATTCTACTAAAGAACAAAGCTTTCTCATTACCAGTCAGCTAAACACTACAAGTTGTCAAATGCATCCTAAAAAGAGAAAGTACAAACACAATCAAACACAAGAAGATTCAAATACTTTTGACTTAGGAAAATAAAGTAAGCTAGCTTGAGATGCTGCTCAAAGACTAATTTAACTAATTAACCAGGATTAGATTTTAAATAACTTTCCTCATTTTATGAAATTACAAAAATAAAAAATAAAAACAATAAATAATAAATCAACCATTTTAAACCTAATGTAGCTTATCCAATTTTCAAAATAAATCAAAAAACAAATAAAAATAAATAAATAAATAAAAAAAGTAAATAAATTGTTTTAAAATAAAAATATATTTCAATTAATTCAATATAAATTAATAAAAAATATAAATAAATATTTTAGCTAAAAATTTAAAAACAAAAAACGGAAAATTACTTAATTTAATAGCTAATTGTATATTTTACTCTATTTTCTATTAAAATTCATTCAATTAATTATTCTTTTAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1249.3 L-2305.0 L-3268.0 S-0643.7 S-3496.1
S-6489.8 S-9379.0 S-12465.9 S-15451.3 S-24584.1
C-0384.1 C-27,897.8 C-41,908.6 C-65,085.9 C-84,925.6
C-102,429.4 C-121,608.7 C-14819.0 C-161,291.5 C-18977.9