Summary
Transcript IDgene_000009343
Gene IDTTHERM_00075810
Length1589 bp
Sequence
GTCGCTTATATTTTGTAAAAATAAAAAGTATTTGTTTTGCAGTAAAGATAAAAAAGTTAGCAAAAAAGAAAGAACTCAAAAGAAAAAGTTATAGAATAGCATTATAAAAAAATATGGAAGGAGAATTTACAAAACTTAAAGCCGAATTAGTTGAAGGTGAGACATAAGAGCAAGCACCTCAATAAAATGGAAATGCAAACGCAAATGCAAATGCATCTCCAAGTGAAGGTAAAACTGAACCCACATAATCGCCCATAAAATAAAAAGTTAAATAGATAGCACCATAAATATAAAAAATTAAATACCCTGTTTGCTAGAAAGGCAATTTCCATGAAGGAGAGTTGCTCAACTACGTTTATTTAAACACAACAAATAAGGAAGACGTTTTAGGATGTGCTGTTTGCCAAGAAGAAAATAAAAAAGGTTAATGGAAACCCTTGAAGGTGTTGCTCCATCAAGCTTTGGAAAATTCAGCTAAACAAGCAAAGTCTGAATTCAATTGTGATGAACTTCTAATTTATCTAGATGAATAATAAAAACTAGCAGAAAAAGAACTCAATTAAATATATGAATCATTCAATGAAAAAATTCTTTCAATTAAAACTTCTATTCTTAGCTTTTTCGATAAAATGAAGGATTAAGTGCTTTCTCATACATCAGCCACAACTGAAATTAACAACCTCTTCGACAATGTATATGAGTTTAATGGAGATGTAGACAAACTTAAAAGTTCCGTTTCAAGGCTTGTTAATTTCATTCCTCAAGAAGACGATGAAGAAGGAGAAGCTGAATTGGAATAAAAAACTATCAAGATTAACATAGAAAATCAATATTAGGAAATATAAAGAACATTAGAAAAAGGTAATAAGGAAATAGAAACTTTATTAGAAACTCAGAAAAAGAGTCTGTCAGAACAGATTCTTTAAGCAAACATAATTTATAAGAATAACATTAAGTTCTGGTTTTCTAATACATATAAGCATGCACAAATTACTCTTGTTTCCAAGAATATTGTTAAATCAAATGGCTCAAATCCTAGCTATAGATTTGCAATTATGGAACCTGCCTTGCCTAAAAATAAGTAATGCAAATTTGCCTTTAAAATTAAGCAAGGATCTACTAACAACTGGCTAGCAGTCGGTATTTGTCACAAGAACACAATAGTCTCCAAGAATTATGGTTTCCAATTTTCAAATCTAGGACATGGTGCTTATATGATTAGCTCAAACGCAGGTACTTGGTCAACTAGCTAAAGTGCATTCAACAATGTAGTTAAGGCATTTAGCTTTGCAAAAAATGATGTAGTAATTGTTGATTATGATCCAATCGGTAAAACAGTAAAATTCTCTAAAGAGAAAAAACCTGACTCAACTTACAAACTTGATATAACTCACATTGATAACGATCCTCTTCATGCTTGTGTCTTATTTTATTATGTGAATGATGAAATAGAATTTATTCAAAATTATAGACCCAATGCAGCCAATTGAAGCTTTATTATGCTCATAAATTGTATAATATCTCTAAAATTTGATATATTTTCTATGTTTCTTTGTGCATTTAGCTTAATAAATCTGGAATATAAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,852.4 L-24,306.1 L-34,223.1 S-010,075.5 S-34,562.9
S-64,851.8 S-94,906.5 S-125,337.2 S-155,467.2 S-244,879.8
C-02,300.5 C-22,613.1 C-45,576.5 C-63,584.1 C-82,990.6
C-104,222.9 C-123,833.8 C-144,973.0 C-164,618.1 C-184,371.4