Summary
Transcript IDgene_000009414
Gene IDTTHERM_00079260
Length885 bp
Sequence
TAAATAAATTACTTTGTATATAAATCTAAGAATATTTTAGATATTAAATTTTAAGAAATTCTACAAGTTGTAAATGGAATAAGAAATAGATGTAGATGTAAGCTCTCAATCATAAGAGCAACAAGAAGAGAAAGAACCTTTTGAAGATTTAATTTAAGAATGCGATGAAAACGCTAGAAAATTAGAGATACTGTATATTTAAAAGGAAAATGAATACCAAGAACTTTGTAAAACTTTGAGTGATTTATAGGATCAAATATGGAATCATTAAAAAGAAGAATATGAGCAGAATTCGATTAACACTGATTAGTAAATTAAGAAAGAAATAGAATAATTATCAAGATTGCTTGCTGAGAAAGAAGAAAAAATTGAAACCTATGAAAAAGAAATTAGTAACAAGATGGATGACGACTAATTAGTAAGAATGAGATCTAAGTATAAAGAAATTTAATAGCATAAAGAAATCAATTTAAGAAAACAATATAAAACTGCTATCAGTGGAGAATAAGAGTAATATCCAGCTCTTAGGCAATATGCTGAAGAGTTAAAGCATGAGCTAGATGTTAAAAAGGCAATAAAAGAAAAATTAGATGAAGAAATAAAGAAATCAGATGAATCTATTAAAGAGCTTAGAAGGATGAAAAGAGATGGAGCTTCTCAAGAACACGAACTGTAAGAAGAGATAGAAAATTTAACTTAGAGATGAAGAGGCATTTATAAACTCATTTCAAAAATAAAAATTTAGTTAGAAAATCTATTCAATCACTATAAATAACTAAAGTTCTAACAAAATTAATTAAAAAAAAGCAATTTAAAAAAAATTAATTATAATATTTTAAACTCTTTAAAATTTGTAAATATTTATTATCCATTTTCCATTTTAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,512.9 L-21,661.5 L-31,093.9 S-01,095.7 S-3728.4
S-61,157.2 S-9866.4 S-12520.3 S-15519.2 S-24597.6
C-01,199.6 C-2542.1 C-4198.9 C-63,685.1 C-82,631.0
C-101,559.6 C-12792.1 C-14552.2 C-16643.8 C-18459.5