Summary
Transcript IDgene_000009467
Gene IDTTHERM_00161490TTHERM_00161480
Length1300 bp
Sequence
TTGAAATTGTGTTTGTGTTATTAAATAATGTAGAGTTTAGATAAGTTATCTTAGAGAATTTAAAGCTCACTCTCTAATAAAAGTGAGATAGTATACGTATATCCTGCTTTGCCTTGCTTCATAATATTTATAGTTAGCATTATTAGTGCATCAGTATACATAACAAAGAAAGGTGACCATCAAAGTTGCGTTTTGTAGAACCCAAATTCAAGTGATTATATATAGGAATACGTCTTAGGATCCATTATTGTAGGTTATATATTCTTGGCAATATATTCGAACATATTATTAGAAATAATCCCTAAGCTAAAAGGAGTAGTAGCTAGTTTTTTATTACTTTTTGTTTGGTCTATAGGATCTTTTATATGGAATATAATAGGAGCTACTTTAGTTTCTAAGTCTTACTGCAAAAGTACAAAATATTATGGAATCGCTGTAATGAATTTGGTAGTGTACTTTTTATTCTTTGGTGGACTTGTCTTCTATTCTATTTATATTTGGATAATTCACAAAAAAGAGGATAAAGCAGATGTCCAAGTCAATCCTAACTATGTTTCTTAACCTTAAAATGTTAACAAAAATAAATGAATGATCCAAATAGAAAAACAAGATTTACTCATAGTTGGATTTTAATTTTTCCAGCTAGAAAACTATTTAATCTTTAAATACAAATTATCATAGGAACAATTAAATAAAAGTTATATATTTAATAAATTTTATGAAACGATTGTATAAAAGAATGAATTAATGAGCGAATGAATACCTTGCTGCAGTCTAGGAAAAATAATACAAATATATAAAAGAAAAATACACTTTAATGCATGTTTTAAATTAAATATATCAAGAAATTTAGAGAGATATTTTATATTTTTGTAGTTAAGATTTGAATTTATAATTAATAATTAATTATACTCTGATTCATTTTTGTGGTTAAGTATAAAGATTGTTATTATTTCTGACATATTTTTTGTTTTAAGCATATAATTATTTTATTTTTGTTTATTTCTACCTAAATAATTAGCTAAATTGTCTGCATTTATTTCGTTTTAACTAAAGTGTTTATTTACTTACTTTTTATCTACTTCTCATTTCAAATAAATAAATAAATATTCCTAGTTTTTTCAGAAGAAAATGAATATTTTATATTTTATTAGTTGCCTTTAAAATTTTTTTAGAGTAATTAATTAACTTTGTTTGTATATAATTTAAATTAATTATTATTTAGTATGCTTCATATTTGCTTGCTCAAGAATCTTTATCTTCCTTAGTAACTGCATCGAGAATATATTTATTATCACAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1989.9 L-22,427.0 L-32,218.1 S-0789.1 S-31,866.4
S-61,828.3 S-91,316.9 S-121,163.3 S-15928.2 S-241,032.0
C-02,033.3 C-2656.6 C-41,542.6 C-6750.0 C-8564.7
C-10486.4 C-12275.5 C-141,150.7 C-161,386.4 C-181,344.6