Summary
Transcript IDgene_000009533
Gene IDTTHERM_00158210
Length998 bp
Sequence
AAAAGCAAACAAAAAATAAAAAATTTATAAATAAAAAACGAAAGGAATAAAAGATTTCTAAAGTAATAAATAATATTAAATCAAATAAATAGCAAATGTCATCAAATATCAATTTATACGATACCGATTGTTCCACCTGGTCTACTAACGGAAAGCTCCTTTAGGTTGATTATGCCACTAAAGCTATTGATCAAGGTTCTATTACAATAGGTTTAAGATCTCAAAAGTTTGCAGTTTTAGTTGCATAGAAGAGATCTAACAGTAAGTTATCAGGTTACTAAGAAAAGATTTTCTAAGTTGATGATAAAATTGGTATGGGTGTTGCAGGTATTACTGCTGATGCAAGAGTCATTTGCAAATATATGAGAACTGAGTGTCTTAACCACAAATATGTATATGGAAGCTAACACCCTGCATAGAGATTAGTCATTAAAATTTCTGAAAAATCATAACATAAGACTTAAACCTATGGCAAGAGACCTTATGGTGTTGGTACTTTGATTATTGCTTAAGAGTCAGACGGTCCTAAATTATTCTAGACTTTACCCAGTGGTGACTTCTATGAATTCTATGGTTAATCTATTGGATCTCGTTCATAAGCTGCTAAAACCTATTTAGAAAATAACTTAGAATTATTTAAGGACTGCAATGATCTCAATACCCTTATTTTACATGGTTTGTCTGCTCTTAAGAAAGCCAACTAAGGTGAAGAAGAATTATTGCCTTAAAGTGTTGATATTGCCTTCGTTGGACTTGAATCTAACTTCACTCTTTTATCTGAAGATAGAGTTCTCTCATACTTATAACAATTAGATACATTTGCCCCTGCTAATTAGATGGAAGTCGAAAATTGAAGTTAAATAAAGCATTTTTAATTTAAATAATCAAATACTTTAATATAAAAAATTTAAATTTAATAGTAAAAACCAATATTTATGTTTATTCATAAATTTTTTTTATTTTTCCATCACATATTCCATCAATAATCTATCAATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-126,926.1 L-229,379.9 L-325,636.5 S-040,523.2 S-321,025.6
S-621,511.2 S-920,484.4 S-1220,037.0 S-1521,283.9 S-2421,683.4
C-09,524.0 C-29,255.1 C-411,525.3 C-68,998.6 C-811,809.1
C-1015,587.7 C-1215,121.8 C-1415,553.4 C-1615,937.0 C-1816,153.0