Summary
Transcript IDgene_000009609
Gene IDTTHERM_00532540
Length1203 bp
Sequence
ATCATAACTCATTCATTTAAAAAGTTCATAAATTCCTCCTTTATCTTAGATTTGAAATGGGATAAAAACCTGATAAGCAATAACCCTAACCATCAATCCATGATAATTCCCAAAATCAAATAACTGAAAAATATGATTGTTTAAAAGAAAAATTAATTTAAGTGAAGTAATAAATCCATAATGCTTAAAATTAAGATAGTTTATTTATTTCTAAATGGGGTTTTATGCTCGATTATAATTTTGGTATTTAGCTGGGGTAGTTAATATCAAATTAGGTTTAATTAGTTAATTTAAAACTTGATTTCAGCATAAATAATTTACAATAAGAAGGTGTGAGAGCTTTGTTTGAAAATTTTAAGAATTTAAATTAGCTATAAATGCTAATTATCAATTTATAGGAAAATAAATTATTAGATGAAGGTGCTGCTGGTATTGCCAAAGGTATTTCGTTATGTAAAAATTTAGAGCATCTTAAGCTTGATCTAGGCTTTAATAAAATTTCTGGAGAAGATAATATTTTTAAACCTTTAGGAAATTTGTAAAATTTGACATTTCTAGATTTAAGTTTCGAAAAAAATACTATTTCTACGAAAGGACTGAAAGACATGGCTTCAGATTTAAGCTCACTCTTTAATTTAATGATTCTTAAACTAAATTTCAAAAATAACTAATTTTCATGCATAGACGGTTTCGATACTATATCATAATTAAAAAGCTTATAATAACTAGAAATATCATTTCAATCTAATTAAATAACAGTAGTGTCTTTAAATAAGTGGTTTTCTGATATTAAAAACGGATTTAATCAATTAATTTCTCTTGATTTAGACTTTTAAGGCAACAATTTTAAAGATATTTTAACAGAATAATTTTAACTATCAGGACTTGCTTAAATTAAGAGTTTAAATAGACTCGGTTTATCAATATACCATAACAATTTAAACATTTGTCAAGAAATATCTAAATTAAATAATATTCATCGTCTTTCTCTTACTAATATAAAGGATAGCTTAGACTAAAATAATTTGTTTAGAATTCTCTCTAAAATGGTAAATCTTAGAGTTTTTGAGATAGTTTTATTAGGGAATTGGGAACATTAGATTTTTCAGAATTTCAAAGACATTTTGAAAGCAAAAAGATTGGTAGTAATAAAAAAATATTAGATATGAAGTTTATTTTATTTGTTTGCATGTTGAGTCACAG