Summary
Transcript IDgene_000009610
Gene IDTTHERM_00532550
Length588 bp
Sequence
ATTACTAATTACTATAAAGATTATGTTAGTGGAGATGACGACAAGCCAAAGTTATTGAAAAAGGAATCTATTTTGTACAAAAGATTTTAATTGATAAAAAAGTTGGACCCTAATTATGAGGATCTCAGATTTGAGACAGGGGAAAGAGATCCCTATTTAGAAAGTAAAATTGTAAATTTTAGAAAGTTAGTGGGTAATAATACTGTGAAAGTGAATTAATTAGTAGAGCTGCCAAAATATTTTACTCGTCCTAAATTTTAATATTACTTAGGCTACGGAGCTCTAAACGCTGAAGAACTAGATACTGTTTTAAATCTAGATGAGAATTTAATGAATAAATATATAAAAAGGAGAGAAGAAACTAATTTCAAAGATTTGAAGAAGTGGGAGGTAGAAAATATGTTAAAACAGGAGGAAAATGAAAGACAATACTTGGAGGAATTTTTGAAGGATTATTTAGAAATGAAGTTTAATGCTCACTACTTTCATGATAAAGATGATATGCTCCTCACAAAAATTGATAGCATTTTTGATTCTATGATTTATGACAACGAAAACTTCAACATTGATATTTAGAAGACTGTAGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1240.6 L-2204.3 L-3278.2 S-0329.4 S-3202.8
S-6232.9 S-9252.8 S-12118.5 S-15249.2 S-24198.2
C-0180.5 C-2262.7 C-4204.2 C-6188.4 C-8269.7
C-10355.9 C-12403.8 C-14492.6 C-16323.0 C-18365.5