Summary
Transcript IDgene_000009673
Gene IDTTHERM_00433850
Length1255 bp
Sequence
GAAATACATATTTTTCAACTTTTAAAAAATTGATTAGCATAGTATTAAGCTTAATAATGAGAAGGATAACTTAATTAAATAGATAGATCGTATCAAATTTCTCTAGCTCCACTGATAGCGTCCTCTTTACTCAAGATAAATTCAAAGCTAAGGTAGTTTTGAACAAACCAAAAGCATTAAACGCATTAGATTTGGCTATGATTAGATAGATTCAAGGCAGAATTGTCCCTTGGACTTAAGAAGGTATTAAGGCTGTATGGATTAATGGAGCAGGCGGAAAAGCTTTCTGTGCAGGTGGTGATATTAAATCTCTTTACGATGCCAAAAAAAGTGGTAAACCCGAAGAACTCCCTATTCTCGATACATTCTTCAGAGAAGAATTCACACTTGATTATGAACTTGCTAACATGAAACCTACTCAAATTGCAGTCATGGACGGTATTGTTATGGGTGGTGGAGTAGGTATTTCAGTCCATGCTCCTATTAAAATTGCAACTGAAAACTCTGTATTTGCTATGCCAGAGGCAAAAATTGCTTTTTTCACTGATGTAGGTGGTGGTTACTTCTTATCTAGATTACGTAGTAACATTGGTTTATATTTGGGTTTAACAGGTGCAAGACTTAAAGGAAAAGAATTAGTTGCAACAGGTGTTGCTAATTACTATGTACCAAGAAATAAACTTGATGCTCTTGAAGAAGAAGTCAAATCAAGCTTAAATTAAAATAGCACACCTAATGATATTAAAAATATTGTTGCAAAATATGCTGAATAGGTTCCTTTAACTTTTTCTAATGAAGAAGAGATCAAGCAACTCTTTAACGGTGAAACCTTTTAATCTATTTATTAAAACATCTAATCTTCAACCTCTGAATTTGGTTAATCAGTAGCTAAGTTGATTAATCAATAGAATGCTATTTCTCTCAGAATCATTTTTGAACAAATTAAAAGAGGTAAAAAACTCAATCTCAAGGAAAACTTTGTCTCAGATTTCCGTTTGACATAAAGATTTACAGAGGATAATGACTTCTTTGAAGGTATTAGAACAGTTTTAATTGATAGATCTGATACTCCTAATTGGACTTATAAATCTCCTTTGGATGTCCCTTAAACTCTAATTGACTAATACTTTGCTCCTCTTCCTTATGAAAAAGAACTAAAAATTTGAAAACTTTAAGAAAACTAAATAAATTAAATTAATTGATTTTTTTTACATTTTGTTTGCATTAAAATATGTTATTATGGCATGTAAGCAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,218.7 L-23,213.8 L-32,646.2 S-0872.3 S-3223.7
S-6188.2 S-9287.4 S-12520.9 S-15385.5 S-24449.2
C-0351.5 C-2335.3 C-4234.4 C-6226.4 C-8360.4
C-10359.2 C-12271.5 C-14361.4 C-16347.3 C-18352.4