Summary
Transcript IDgene_000009684
Gene IDTTHERM_00433610
Length1333 bp
Sequence
TAAAATCTGTTTTTATTATAAAATAAACAAGCAAACAAAAAACAAGAAAGTTAGCTTCGTCAACAAAAATCTTAGCAGTAGCATTAAAATTTGAAAAAATGGTTCAATTAAGTGATATTTTGAGTTGCCCCGATAACACTGACGCTTTAGCAAATTAAATTATTTCAGGATAAGAATACGATGTCCTCTAGAAGGCAATTTAAAATTTAAGCATTGATGATCAAAAGCTCGTTTTTACTTAAAAGTTCTTAAAGAGCTTGATATCTATGTACTCTAAAATAGACATTAAAAATATGCAGACCATCGGTGAATTTATAGTTAAAACTCTCAAGGACAAAATGTTTTTCGAATACGAAGTATATCAAACTCGTGTTGAATTGAGTAAAGTTTATGAGGGTATGAACCAACCCTATCTTGCAGGTCAAATATTGGCTTAGGTTAATTATGACTCTCCTAAATTACAATTAAGTGTTAAAGAAAAGGTTGATAAATACCTTTCAATTATTACCTTCTTCTTTGAAATGGAAGAATAAACTGCTGCTGAAACTTGGATCAGCAAAGCAGGTAACATCAACTATGATTTAATCGATGATAAATATTACAAATTCAGATACGAGAATTTATTCGCTGTCAACTTGGATTTCCAAAGAAAGTTTTTACCTGCAGCTCAAAAGTATTACTATTTATCAAACTACCCTGACATTGACTTTGAAGAAGCTAATTTGCTCTTAAATGCTGCTTCTCAATGTGCTATTTTGGGTAATGCAGGTCCACTTAGAACTCGTATCCTTGCCACCCTTTATAAAGACGAAAGAATTCAGTCTATTCCTAACTTCGAAATGCTTGAGTTGACTTACATGCAAAGAATAGTTAGCAAGGAGTAAAAGGATAAATTTGCTGGATCTTTGAAAAAGCATCAATTATAAATTTTAAGAGAAAACTTCACAGTCTTAGATGAAGCTATCTTACAACATAACATCACAGCTGTATCTTAGGTTTATGAATCTATCACAATGAAGTCATTATCTCGTTTGGTCTACATCGGAAGAGATATCGTGGAAGTATGCATCCAAACTATGATTGAAGAAAAAAGAATTAATGCCAAGATTGACTAGTTAATTGATACAGTAAGTTTCTAAAGAGATGAAGATATCCCTGTAGATTTTAATGACAGAATTAGCTAATTCTGTGGTAGACTTAATGAATTCTATGAAAAAATTACTGCCAAGTGATTATTTGAATAATAGTTTGTATGCATTTTGCACTTAATCCTTTTTGTATAAAAATATTATTCTAAAAACTCATTTTATAAATAAATTCCAACTACAAACAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,591.4 L-25,041.6 L-35,830.6 S-02,988.3 S-34,453.7
S-63,821.6 S-93,484.2 S-124,943.8 S-154,862.6 S-244,072.2
C-01,545.4 C-24,888.3 C-45,899.0 C-63,589.7 C-82,370.9
C-105,073.0 C-123,636.7 C-144,163.6 C-163,631.4 C-183,439.9