Summary
Transcript IDgene_000009688
Gene IDTTHERM_00433450
Length562 bp
Sequence
TAAAAATAGTCATAAGCAAAAAAATAAGCAAGCACGTTAGTAATAAGGAGTATAACTCATAAAATAAATAAATAATAAACATACTCAAAAGTTTAAAATAGAAATAACTAAATAAATTTTGAAATGATTAGAGATTTTGTATTGCAATAAACAACAGAGCCAGAGAAGAAATTTAATTCTACAGTATTAATAGGTAATTGGTATGAAGAGAGATGTGATCCTAACAGAGAACAAAGCAAATTTTATAACGAACGCAAGTTTGCAGATAACAATTACTAGAAATATACACTCTCTGAAAATAAATTCCAAGACACAAGCAACAGCTGGTTAAATTTCCAAGAAAATAAACCAGAAGTGAAGAATGACCAATTCATCACTATGAATATGTAAGAATATAAAAAGCCAAGTGAATAAAAGAGAAATTCTGAACTAAAGCCCTTCATAGTAAAAAAATCACACTTTGACAAGAATCCTCATGAATTGGAAGAATATAGAGAAAAGTGGACTAAATCTGCTCATACTTTTGATAGAATGTACTTGGGAACATAAAAACCTAACTGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,472.3 L-22,394.0 L-32,322.3 S-01,665.0 S-31,121.3
S-61,761.7 S-91,089.3 S-12781.8 S-15884.2 S-24877.9
C-0684.4 C-2453.3 C-41,487.1 C-6813.8 C-8447.0
C-10250.6 C-12676.5 C-141,150.8 C-161,003.0 C-18800.8