Summary
Transcript IDgene_000009748
Gene IDTTHERM_00418280
Length3033 bp
Sequence
TAAATAAAAAATAAAGATATATAGATACATAGAAAGTCCAAGCAAAATGTTATCTAGAGGTGTTAAAAATCTCATTTCACTCCAAAAATCTTACTTGCAATCCAAAAATTTTATTGGATTGACTTTAAGAAACAAATATTACTTTAGGAATAACAACAATGATGAAGGCGAAGATAGAGCTCCAGAAGGGTTTGAGAAGTTCAAAAGAAGGTCTAAAAAGAAAGCTGATTAGTCTTAAGGTGAATAGACTGTTGAATAGCTTGAAAAGGAAAATAGAAAAGATAAAGAAGAAGTTGAAGAAACAGAAGATGTAAGCGCTTCAAAGTAGAAATAGGTTAATGAAGAAGATGATGACCCTTTCAAGAAATTCAATAGAAAAAGCAATAATGATAAGTAGTCATCTAAATCTAGCAAGTAAAGTGTAGAGAAAAAGGAAGAATCTTCTACAGAAAGCAAACAATAAGATAACTAGGAAGTTAATAAAGATGAAAGTGATAAAAATAAGAAAGATTGGTCATTTACATATAGTCCTAAAATCTTTGGATTCGAAGACAAAAATTCAAAAAAGAAAGATGAGTAAAAAAATAAATAAGAAGAAAATCAAAATGAAAAGAAAGATGATGAAAAAGAAGATCACAATGAGCATGAAAATAAGCGTAAAAATGAAGATTCTTCATAATCTGAATTTGCCAAAAAGTTTAAAGAATTCTGGAATAGTGGAAACAATAAAAAATATATCAGTGCAGCTATTGCTATTTCTATCTTAGGACCTTCTCTCTATTATTAATACGAAACTCAACAATATATATCTTATACTGAATTCTATAAAAATTATCTTCAAACTGATAATGTTAGATCTATCGCTATATAAAGATTACCAATTGGAAACAATTTGAAAACTTATGCTAAAATTGTAACTAAGGATGGATCAGTTAAAAAAATTGTTTTAGGAAATGTTGATCACTTCCTTGAATAGGTTGAATAATACCAAGTCGAAAAAGGAAGAGATATTGAAACTCTCATTCCTATTTCATTTGAATACCTTGTCGATTTAAATAAAACACTTGATTATTCTTTCTCATGGTTATCCACTATGGCAACTATTGCAATCGGTTACCTCTTCTACAAATCCATGAAGAGCGGTCTTGGAAGTATGAAGGGTGGTGGCGGTGGCTAAGATATCTTTGGTATGGGTAAATCAAATGTTAAAGTTTTTGGTATTGATTCTAAGGTAACAACCAGATTTAAAGATGTTGCTGGCCAAGATGAAGCTAAATAAGAAATTTAAGAATTTGTTGATTTCTTGAAAAAACCTGCTAAGTATAAAGCTATCGGTGCTAAGCTTCCTAAGGGTGCTCTCTTGACTGGTCCACCTGGTACTGGTAAAACTCTTCTTGCTAAAGCTTGTGCTGGTGAAGCAGGAGTTCCTTTCTTTTTCATTTCAGGTTCTGATTTCGTTGAAATGTTCGTCGGTGTTGGTGCTTCTCGTGTGAGAGATTTATTCAAATAAGCTAAGCAATAATCACCATCTATTATCTTTATTGATGAAATCGATGCTGTTGGTCGTAAGAGAGAAAACAAGATGGGTGGTAATGATGAAAGAGATAACACCTTAAATCAACTTTTGGTTGAAATGGATGGTTTCGGTACTGATGCAAATGTCATAGTCCTTGCTGCTACAAATAGAAAAGAATTACTTGATCCTGCCCTTACTCGTCCAGGTCGTTTCGATAGAACTATTGAAGTAACAAATCCCGATATTGATGGTCGTAAATAGATTTTCATGGTCCACTTAAAACCCTTGAAGCTTCATCCTTCTAAAACTATGGAAGAATATGCTAAACGTCTTGCTACTCTTACTCCTGGTTTTAGTGGTGCTGACATTATGAATTTATGTAATGAAGCTGCTATCATGGCTGCTAGAAAAAATAAAAAATTTATTGAATCAATTGACTTTGAATTAGCTTCTGAAAGAGTTATTGCTGGTTTAGAAAAGAAGAGAATTGTTTCAGAAGAAGAAAGAAAAATTGTTGCTGTTCATGAATCAGGTCATGCTGTAACATCATGGTTCTTAGAAGGTGGTCATCCTTTACTTAAACTTACAATCATACCAAGAACAAAGGGTTCTTTAGGTTTTGCTTAGTATTTACCAAACGAAAGCAGTCTTGAATCAAAAGAAGAATTATTAGATAGATTATGCACTATCCTTGGTGGTAGATGTGCTGAAGAAGAGTTCTTTGGTAAGATCACTACTGGTGCTTATGATGATTTGAAAAGAGCCTATGAATTATGTCATGCTCTTGTAACAAAATACGGTATGAGTGAAAAGCTTGGTTATGTAGGTTACATTGAAAACGATTACAGCAAGACTTATTCTGATTAGACAAATACATTAATTGATGAGGAAATTAAGAGACTGATTGACGAAGCTACCTAAAGAACAAGAGATCTCATTAAGAAATATAGATCTTAAATCGAAGGGTTATCAAGTGCTTTGTTAGAAAAGGAAACATTAGATTTGAGATAAATTTCAACTATTTTGGGTGAAAGACCTTTCCCTCCCAAGTCAAATTACAAAGCTTATTTAGAATTATAAGTTTAAGATGATGCCGAAAAGGTGCAAGAGTAGGCTGAATCCACTATTGAGGGTGAATCAAACACTCATGAAAATAAAGAAAAGGAAAATGCCTCAGCTGAAAAAGCTTCTCAATGAAATAGCATAAAGTGATTTGATGAGAAGCCAGCCAAAATTTTGAATCGATTAATCAAATCAATCAATAAGTTTAAATTCACAATAAATAAAATAAAAAATGTACAAAGGAATCTGAAAAACTTTCTCTTTAATTTAAAATAAAAACTCAAAAATAAAACAATCAATCAAACAACATTTATCTCAAAAGAATTTTTTCTTATTTCTCTAATATATTTAATTGATACCTTTATTCATACATACATACATAAATAAATAAATGCATACATAAATCCATCTTACATAATTCACAAATTCAATGAGCAATTAAATTTTTATAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-113,397.3 L-210,645.8 L-39,528.0 S-04,942.5 S-3909.7
S-6905.8 S-91,299.1 S-121,691.0 S-152,129.0 S-243,100.3
C-01,637.8 C-21,204.6 C-41,033.5 C-6623.8 C-82,429.2
C-103,179.4 C-122,554.9 C-141,430.8 C-161,585.7 C-181,003.4