Summary
Transcript IDgene_000009795
Gene IDTTHERM_01123860
Length4060 bp
Sequence
ATATACTATAACTCAACAAGCAAAAAAGAAGAAAGTAGGACGAAGGAGTGAGTAACAAAGACATAAATAAAACTAGAAAGTCCTAACAGTATAATTTAGCAAAAATGTCAAACGACGACACGGGCGTGCAAAATTTAGATGATTAGGATTCGAAGCGCTTTGGATATGACTACTAATATGCTAATGTCTCAAAGGACAATAGGTCTTGCCAATTTTTTTACTATAATTAAAACAAGTTAAAGTATTAAAGTGAACCTAGAAAAATTACCACTGGTAGACCCGATGAGTGTCTACCTAACAATAATATAAAGACTAACAAATACACTTGCTTAAATTTCTTTCCTAAAAACCTCTATTTATAGTTTAGCAAATTAGCAAATATTTATTTCTTGTTTATTGGTATTATGTAGTCTATTCCTTAAATTTCTATTTCGAATGCTATACCTGTCATTTTTCTTCCCTTAGCTGTCATAGTTGCAATCACTGGAGGAAAAGATTTATATGAGGATTATAAAAGAATGAAAAGTGACAGAACAGAGAACGACTAAAAAATTTAAATTTTTGATAATAAATCAAACAGTTTTAAAGAATTTACTTGGAAAGAAATACGACCTGGGCATATTGTCAAAGTAATGAGGGACCATTATTTTCCTGCTGACGTAGTTTTATTAATGACTTCAGATCCATAAGGGATTTGCTATATCGAGACAAAAAACCTAGATGGTGAAACAAATTTAGAAAGTAAACAAGCAGATCCTCGTATAAGAGATAAATGTATTAAAGATGAATCTAAATTAGGCTAAGAATGTGTGATTATACATTATGAAAGTCCTAACAAAAGAATCTATCGTTTTGATGGAAGTTTTGACACTAAAATGGGTGAAAATTATCAATTGAGTTACACAAATGTAGTTCTTCGTGGATGTTGCCTTAAAAACACTGAATATGCTATTGGAATGGCTGTTTACACAGGACATTAATCTAAGATTATGTATAATCTATATTAAGGAAGTGCTAAGAAAAGTACTCTAGAGCAACTTATAGGAAAGCTAATCATTTAAATTTTTTTGTTATAGTTAGTTGTTTGTATTATCTGCGCATCTATTTATATTGGATTTTATTCTTTGGTGGGCTACGAGCTAAGTTACTTAGTTATTAAGGCTTCATCTGATGTCTACGAAGAAGCTAATGCAATCAACTTTTTTGTAAGACTTGGTAACTGGATACTCATTTTCACGAATTTTGTCCCAATCAGTCTTATAGTGACATTAGAAACTGTTAAATTTATTCAAGGAATGTTTATGACAGCAGATGAAAAAATGGGAAACCCTACTGTATAAGCTTCTAATTTAAATGAATAATTAGGATAAATAAATTACATTTTTTCTGATAAAACTGGTACTTTAACTAAGAATGTTATGTAATTTAAGCAAATAGCTATTGGGGACACTCTTTATGGAGGAAACGAATAAAAATCTGAACAGCCTCTTACTGATGAAGAAATTATGTTCAATTATCCTAAAGTAGAGAACGTTGATTTTAGAGATAGATCATTTTTAGATAAAGTTAAGGATGAGGAAGATCCTGAGCATGTGAAAATTCGTCGAGTATTGTTTATGCTAGCCTCTTGCCATACTGTAACTTCGACAATAGATCATTAGTAAAACACTATCTATACAGCATCTTCCCCTGATGAATATGCAATTATTAACTTCACTAAATTTGCTGGTGTTGAATTTTTAAAAGTAGAGAAAGTAGATGGAAATACAAATATATTGATTAGGTTTAAGCAAAAAATATTTTCTTTGCAATTACTGCATGTATTTGAATTTGATTCGAATAGAAAGCGCTAGTCTGTTATTGTCAAAGACTAAGATGATAAATATTTCTTATTTTGTAAAGGAGCAGATTAAGTGATTACTATGAATCTCAGTGAAAATACAGACCCGATTATGCTCAGAAATTTGAATGAAAAATTAAAATACTTTGGTAGTCAAGGATTGCGTACCCTCATGCTTGCTGAAAGACAAATCGATAAGCAAGCATATGAAATATGGAGTGAAAAGTATTTAAAGGCACGTTCATAAGCAGAAAACAAAGACTTAGAAATCGAAAAGCTTTAGGATGAAATGGAAACTGATTTAGAAATTTTAGGAGCTACTGCTATAGAAGATAAATTGCAAGATGATGTTTCAGATACTATTAAAGCATTGAAAGATTCTGGAATAAAAATTTGGGTATTAACTGGTGATAAAATAGAAACAGCAATAAACATTGCCTATTCTTGCAAATTACTTGATGATACTTTAGAAAAAGCAATTATTGATGTCGAGGAAGAAAATGAAGTTAACAAATTCCTCTAGGATACTCTTTAAAACCTATTAGATGCTGAAGCAACATATATTTAATAATAAAAATAAAATAAAAAAGCAATAGATGAAGATGCTTTGAAAAACCATGCACTTATTATATCAGGTTTTGCTCTAAATCATATTTCGAAGACAGAAATAAAAACACTTATTATGCAAATTGTTAAATATTGCAAGTGTATTATCTGCTGCAGAGTATCCCCAAAATAAAAATAAGAAGTTGTTACTACAGTTCGTGAAATGGAAAAGAATGCAACAACACTCGCTATTGGTGATGGAGCTAATGATGTAAATATGATTACAGCAGCTCATGTAGGAATTGGTATAAAAGGTGTAGAAGGTTAGTAAGCTGCAAGAGCTAGTGATTATTCTATTAATTAATTTAAGGAATTAAGAAGGTTGCTATTCTATCATGGTAGAGAATGTTATCGTAGAAATTCAAATTTAGTACTATATAACTTTTACAAGAATGTCTTGCTTGTGCTTCCTCAATTTTGGTATGGTTGGACTAATTGGTTTAGTGGCTAAACACTATATAACTCCTTCATCTATTAACTTTTTAACATCTTCTTTGCATCACTTCCTATTATGGTTTATGCAATATGGGATGAAGAATATTCCGATGTAGTGCTCGTGAAAAATGAGAAAAAGAATTACTACGAATAAGGAATAAAAAATAAGCTTTTCAACCAAAGAGAATTCTGGAAATGGAATCTGATAGCTTCAGTACAAGCTGGATTGATTGTCATATGTTCACTTTTCCCATTAGAGCTGAATTTTGTTACATAAAATGGATAGACTTAGTGGTTTTGGGCTACTGGTACTATGGTTTTTGGTTTAGTTGTAGTTATTTCAAACTTAAAAATCCTAATTATGTCAACAGATCACTCTTTGGGTTCTTTAATGATCTTAGCTTTATCTATGCTTCTTTATTTGATTACTTGGGTAATCGTGAGCAATTTGAATTCCACAGAAATTTATAGAACTCTTGGATAAATGTTCTAAACTCCTAATTTCCACCTTGGTAATATACTATGCATAATTGTTACATCATTCTTTGATTGGGCTTTTTGTTTGTACAAAAAATGGACTTATGAGTTTGATGAAAAGTAGCAAGTAACTAAGATTGATAAGACACCAAAATAAGTTAAAACAAATAGTACCTTCCCAATTAAAATGCGTACTTTTAATACAGATGTACCTAAAAAATAAAATGGTTTTGTCAAAGATCAAACTAAAGCAAATTATGCAACATAAGAAATGAAAAGAACTTATTATCAAGATGTCAATACTGGTTATGCTTTTAATTAGATAGATAGACACTAATATGTCTAAAAATAGAAAGAGTAGCAAATGTTTTGAGAATTAAGTAATAATCCTTTTATTTTCTAAATTACTTATCCTGAAAGCTATTAGTAAAACAAAATTTGGACATTATTTAAATATGATGGTTTTGCTGAATTTTATTTATTAAGTAGAATTTTTACTTACTCTAAAATATTTAATTTGAAAAAAATATACATGAATTGAATTGCTTATCTAACATACTAACTTTCTCAAAATCTTATAATCTTTATCTTTAAATTATTAAAAATAAAAAAGATGCTTTGTAACTTTTTAAGCATCTTAAAATTGGTTATTTATTGATCTATTTTAGCCAAGAGTTATATATATATATATACAAATACAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,214.7 L-21,635.4 L-31,642.7 S-03,389.2 S-32,641.2
S-62,424.5 S-92,385.4 S-122,734.0 S-152,532.0 S-243,217.1
C-06,921.8 C-24,224.7 C-44,499.2 C-62,815.7 C-82,174.4
C-102,732.2 C-122,802.9 C-142,473.4 C-163,248.2 C-183,608.6