Summary
Transcript IDgene_000009800
Gene IDTTHERM_01123950
Length745 bp
Sequence
TCCAATATATTTAAGTAAGAAAATACAAATAAATAAAGAAAGAAATAAATAAATAAAATAATCTGAAATGGCTGGCCCTACTCCTAGAATTATGAAAGAAACTCAAAAGCTTCAAACAGAGCAAGTCCCTGGTATTGATGTAGTTCCAAATAAGGACAACTTCCGTCACTTCTACGTAAAGATTCAAGGTCCTGATAACACTCCTTATGCTGGTGGTATCTTCACTGCTGAATTATTATTACCCGAATAATATCCTATGAATCCTCCCAAAGTTATTTTCTGCACCAAGATTTATCATCCTAATATTGATAACCTTGGTAGAATTTGTTTAGATATTTTGAAAGATAAGTGGTCTCCTGCCCTCTAAATTCGTTCTGTCCTCCTCTCTATTTAGGCTCTCCTTTCATCCCCCAACCCCGATGATCCTTTAAATAACGAAGCTGCTGAATAATGGAAAAATGACGAACAAAATGCTTTGAAAAAAGCCAAGGAATACACTTAAAAGTATGCTACAGGAAAGTGAAAGAAATTTATTGAAAGACTTATCTAAAGACATACATACATAAAAGAAATCCATATGACTAATATTTTCAAAAACATTTAATGCATTATATAAAAACATAATATAAGAATATAGCGATCTATTTACTTAATAATAAATATTTTCTTTGTAGCAATCAATCAATATCTTATGTATAAATTTTTTTAAATGACTTTATTTTCAGATATGTCTAGATTCCATAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-118,359.5 L-218,281.3 L-318,302.4 S-012,551.4 S-38,688.1
S-611,689.6 S-910,125.1 S-129,835.8 S-159,546.7 S-249,112.3
C-08,031.0 C-26,157.6 C-412,279.9 C-69,331.4 C-88,551.7
C-108,870.6 C-1212,506.6 C-1414,985.4 C-1610,664.1 C-189,089.7