Summary
Transcript IDgene_000009864
Gene IDTTHERM_00094140TTHERM_00094130
Length1329 bp
Sequence
ATTCATACATACATACGCACATAAATTCATATATCCTATTTAAAATACAAAACAAAACATAGATTTTACTGAAATTTAAAGAGGTTGAAAATGAGTACTGCAACCAATAATATAACCCAATCAGTAGCACAGTAGTAACAGCAACAACAATAGTAGATTTCAAAGAATATGTTAAGTAGCGTTCCGATGCAGCTCAATAAAGATTAGGCCTTGATTTAAAATACAGTGCAGCCAAATCAAGCAAATTTTCAGTTTATAAGTCATCGCAAACAAGTTTCTACAAATGAAAGATAAAATTTTAGCAGCTCCCCTGTTAAAATTACTAATAAGGCAGCAGAAATATCACCTCTGGTTGTTGCTAACCCTTCTTAATTAGCGAAACTAAATTTGTTTTAGACCGTAAACGATCCCTCCTATTTTAAAAAAATTATATAGGCACCTACAAGCGGTGAAAACAATTAGATAATACCAATAGGCTAACCTAGACCATAGAATTTAACTACAAAATATATTCGAAATTTCAGTCAGTTTTTGATTGAGATTTAGAAAAATAAGTAAGAAAGTTAGTATTTGTGTTCTCACTGCAAAGACTTATTATGGGATCCAGTAAAATGCACAGAGTGTCCTACCTACTATTGTCACTCATGCGCAAATAAAAACTATACAAAATAAAATAAAAAATGCAATACTTGCTAAAAGATATTAATTACCATTCGTGCAGGAGAAAATATTTTGAAATAACTTTAAAAAATTAATTTAATGTGCCCAAACAGCTTAAATGGCTGCTAAGCTTACTTATCTTACAATTCATTTGAATTGCACTAGCAGGATTGCAGGTTTAAGAAATCTAAAGGTTCAGAAAATTTTGTAAAACCCCCAATTACCCAAGAAAGCAAAAAGAGAGAATCAGCTCCAATAATTCCGATGTCTGCACTTCCTACTACTAAAAAAGAAAAGAAGGACTTAGTGAGCTGTATCCATTGCTATAAAAATGTTTTAAGACAGCAAATTGAATAGCACTAAAATTCATGTCCTTTAAAGTTAATCCCATGCCAATTTTGTAAAAATGAAGTTCCATCTTCTCATTTGAGCGTCCATGTTCAATATCGCTGCACGAAAACTATTTTTTGCTCGAAATGCTCTGTTAATGTACCATACGAGTAATTTAACACACACATAGGAAACTGCAGCATGTATCCTTCTATTAAGTGTTCTTTTTGTGACCAAAGTTTTTACAAGTCAAGCATTTCTGATCATATTGCTGCCTGTTCTCAAAACCCTACTAACAAATAAAAAAAAATTATGAAATCTGAAAACATAAGCTCTAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1652.1 L-2720.6 L-3685.5 S-0373.6 S-3619.8
S-6617.0 S-9744.3 S-12589.0 S-15550.4 S-24675.7
C-01,124.4 C-23,949.1 C-41,464.9 C-6745.7 C-8314.0
C-10652.2 C-121,048.2 C-141,281.7 C-161,358.4 C-181,570.2