Summary
Transcript IDgene_000010166
Gene IDTTHERM_00384680
Length951 bp
Sequence
GATTAAAAGAAAATACAGAAATTAAAATGGAGTAGATTACATTTAAGGAAAGTTGATAACGATGCCATAAACAAATACAACTAGTAGTAGCTCTCTTGTTATTAAAAAGGATGATAAATAGAGCTTTGCTAGGGTAATTAGAATGCAATCAGAAAAGAAATTAACTAATAATGATTCTTTCAGATCTGAAAGTAGATAAAAATTAATCAGAGATGTATACACCCCAAGTTAGAAAGATAAGCTTAACTAATCAATAAGGAAACTTAACTCCTCTTAATCTCGTTAATCAGTCAATAATTCTTCACAAAAAAACGTTTTGTATGGAATGAATAAATCATAAACATAAAGAAAGTCCTCAGCAAAAGAGCAAGTTAGGATGATTTAAAATAATCTAGCTCCTCAAGATAAAGAATAGGATAAATAGTTTAAAAGTCTTTCCAAGCTAGTCGATTATAATCTTTACAAAAATTAATCTTCAAATGCAAACAGATAGAGGATTTTTGACTAGAATAGATCTCAATTACAAGGAAGGTCAAGTATGCATGCTACCACAAATTAATCAATATTAAAGGTTTAGTAGTTATAAAATAATTAATCGAGTAAAACTACATATTAAAATTAAAAAAATTACCATAACTAAAATAAACCTTAGTTAATTGAAATTAATGGAAATTCATCTAGTATTCATTTGAAAAACTAATCTTTAGCTATTTAAACATCCAAGGCATTATCTAGTAATTCAGGCAATTTACCTTTACTCACATCAAAATCTAATACTCTTGGATCTCCCTCTTCTTAGCCGAAAACATTCAGATATGGAACAGAGTCCGTCTAAATAAAAGAAAATAAAATAATTAGATAAAAAGATTAACCTCGATATAATTATCCTAAAAAATATGAAAATAAAATTGCAAATTCACACTAATTACCATCAAATCTTTAACCTAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1678.7 L-2785.1 L-3710.4 S-0654.7 S-3333.5
S-6451.8 S-9247.2 S-12219.7 S-15167.2 S-24149.1
C-0292.8 C-2959.3 C-4292.7 C-6494.6 C-8401.6
C-10227.6 C-12318.5 C-14379.2 C-16355.9 C-18295.5