Summary
Transcript IDgene_000010307
Gene IDTTHERM_00424720
Length2200 bp
Sequence
ATAGATTATTGAATTAATTAAAAAGAAACTTACTTACAATCTATAAAAATGTTTAAATTTACTTAGAAAAGCTTAGCATTTGGAGCTAACAAAGCAAATAATATTTTAAGGGGAATTCAAAATTAAAGATTTGCCACTAAGAAAGTTGTTCCTAGCAATCTTGATTAATATGATGTCATTATTATTGGCTCTAACATGGGAGCAGTACTTGCTCGTCACATAAATGAAATTACAAATGGTAGAAATACTGTTTTCGTGGCCAGTAGCAGCTCAATTAGAGAACAACATCATTTGAGAGTTGCTTACGAATTAGGAAGCTGTAAAAAGGAAAATTTCATTCTCGATACAAAATCAATTATTACTCCTTTTATACCTCACTCTGATGGTGTTAGAGTCAAAGAAATACATCCTGAATCTAATACTGTAGTACTAGAGAATGATCGCACTATTTAATACAAAAGATTAGTTATTTCAACAGGATTACAGAATAATTTTGAAGCAATTCCCGGTCTTAAAGATGCTGTTTATGATTAAGATCATCCTGCATTCTCACCTTATGATGTGACTGGAAAATAAGCTAGTGTTAAAGATCCTTATTATTGGTATAACTTCTATGGTGGAAAATGCATCTTCTACATTCCTAAATTCCCTATTAGAGGAGAAATCCAAGAATATAACTTCTTAGTTGCTTATGACCAATGGGTAGAGAACCAAAAGAATATGAGCTAGAAAATTGATATTGAATTCACAATTGTAAATGCAAACGATTCATTCTCTTAGTACAGCAAATAAGCTGATGAATATTTTAAAGAAGAACTTAAAAAGAGAGGAATTAAGGTTTTGTACAATACTTAAATTGAAAATATTGATAAGCCTAAGAGATAAGTGACTGTTGTTGGAAAAAATGGAGGAAAAACTGTTGAAAAATATGATAATTTATATTCAATTATTCCCACTAAGGGTCATGAATTTTTGTAATAAGCTAATCTCTGTAACGAATAGGGACTACTCAGCGTTGATAGCCACACTCTCTAACACAAGAAATATAAGAACATCTTTGGTTTTGGTGATATTATTGATGTCCCTACAACAAGAAGTTTCTTTGGAACATAAGAATAACTAAATGTAGTGAGACAGAATGTAATTCGTAGTTTACATGGATAAAGCTTAACTGCATAGTACTTTGGTTAATCTAAGACTCCTTTATACATTGGTAAGAATAAACTTACTTTTGTATCTTAAAATTATGATAAACCTTCGAAATTCAGTATGCTTGATAAAGAAGGAAGACACCTTTGCTATTTGAGAAACTTTATTTATAGTCATTTCTATTAGTATATTAACACTGCATATTACAAGTTTGCTATCTGGGGCAAACCATACTTTTTATGGCCTAAGACTTACCACTCCAGCTCCAAAGGAGTTTAAAATGTCTCAGAAACTCATACAGAACACAGTGAAAAAAAGGATGTTAAATAATCTAATAAAACTGGTTAATAATTTGTATACAAACCTTAAGCATAATTTGCTTGTCTTGATGTAATTTCTCCAGAAATTCAAGCTCAATACTTTGTTGTTAAGGACCCTTCTAAAAGTGTTTAGAATATTTTTAAGAATGAACTGAATGAATAGTAAAAGTAAGCAAAAGAATAAGAAGATAGAGTTAAAAAAGCTGAATAAGAATAAAAGAAAAAGGAGTAATAATTGAAGAGAGAGAAGGAAGAAAAGGAGTAGAAAGAAAGAGAAGAAGAATATAGAAAGAAGAAAGAATAGGAAGAACTTGAAAGAAAGAGACAAGAAGAAGAATAAGAAAAGAAGAGATAATTAGAACTTTAAAGATAGAAAGAAGAATAAGAAAGATAGAAAAAAATAGAATAAGAGAGACTTCAATAGGAAGAACAAGAAAAATTAAAAAAACAAGAGTAAGAAAGATTGAGATAATAGCAATTACAAGAAGAAGAAGCTCTTAAGAAATAATAACAACTTGAAAAGGAAAAGCAAGAAGAGTTAGAGAAATAATAAAAGCAATAAGAAGAAGCAGAAGTTGATGCTAAATAAGAAGATGAATAACCATAATAACCAGCTTCAAATCCTTCTAGTGAAAGTGAAAGTCCTAAAAAGAGAAAGGGCAGACCTAAAAAAGAGAAAAAAGAGTGAATGAGTGAGTAAGCAAGTAAGTGATTGAATGACTCATAATGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-19,656.1 L-210,682.5 L-311,419.1 S-02,594.1 S-3936.2
S-6682.2 S-9716.8 S-12836.5 S-151,062.8 S-241,026.9
C-0680.6 C-2336.9 C-4314.9 C-6305.3 C-8819.1
C-101,496.9 C-121,711.5 C-14890.7 C-16520.8 C-18471.0