Summary
Transcript IDgene_000010392
Gene IDTTHERM_01692300TTHERM_01693300
Length846 bp
Sequence
TAAAAAATAAATGGATACAATCAGCTAAAATCTTGTAGAATCCTAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCAAAACAGGAAAAAAGTCAAAGAGATGTACAGAATGAAAGGTGTCTAAATGCTCGATAAGCCGGAGTTAGTCATTTCTGATATCTAAGAACCTAAGTTATAACCTAAATAAGCTTCAATTTATTATACTATGAAAAATGAGTTAACTAAAAAAGGCTACTCTGATTTTAGGTTTTTAGGGCAGGGAGGATAGGGACTAGTCTTGCTAGTAAAAGATTCTAAAACTAATATTAGGTATGCTATCAAAGGTGTTCAAATAAGAGATCCTTTCGGAAATTTTTATGAAGATGTCAACAATCAAGTGAAACAAGAAGTAGAAATACTCAAAAAATGTAGAGACTCTCCTTACGTAGTCAGTCTTTTAGATTAATTTGAAGGAGAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCACCTAAATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATGTCCGCAATCAAATATGCTAATGACATTGCTCAAGGTATCTACTACATTCATTCTCAAAACTGCCTAGTTAATGATCTGAAAATGGATAATATCTTAATTGACTACAATGGGAATGCCGTTGTTTCTGATTTTGGTTTGGCAGATAACCAAATAAGCAAATCTGGCTATTCAACAAATCAATATATGGGAAACTTCTTGTATCAAGCACCAGAGTGTTATGACCCAGCTGATCTATTCGGTAAGGTTTATTATGATGAATATTTAAAATTAGGCGTCACAGTGAGACAAGAACCAAGCAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,176.8 L-21,979.2 L-33,914.6 S-02,026.4 S-32,409.5
S-63,692.2 S-92,671.6 S-124,437.9 S-153,922.4 S-243,713.4
C-05,373.0 C-2931.8 C-41,484.9 C-6746.3 C-81,774.4
C-101,977.0 C-122,110.4 C-142,071.2 C-164,184.9 C-183,486.5