Summary
Transcript IDgene_000010414
Gene IDTTHERM_00490830
Length2683 bp
Sequence
GTTAATTAGTTAGTAAGTAAATAAATAAGTTTTTAGATAGATATATTGATTTGTTTGCTAAAGCCATAAAATTGAAAGAACAAGAGAGGTAGGTGTAAAGGTGAATAGTTCGATTCTTTTTAACTTTCAATACTCCATTACTATTGATTGATTGAATAATCAGATTGCTTTAGCACTTTAAAAAATTAGTTTTGGCAGATACATATTTTTTAGTGAATAAACAAATGTCATAGGCACAACAATTAGAGTTAGTCGAGGATGAAGAAATAGATATCATATAAGATGATTAATTACAAATACAAAGTAGGAGTTAATAAGTAGTGATTAAAAATGAAAGAGAGTTTGATTGGGTAAGGTATAAAACTGAGGAGTGTTGCGATAAAGAATGTGCTTTGTTAGATAAAAAGAAAGAATTTGTATTTCCCTTATTATTTAATTGCATAAAGTGGCACAACCAATTTGATAAAAGACGTAAAATAGTTGTTAAAGACAAAAATAAATTCAATTACAGCAGGCTTTTTGTCAAGGAAACAGATAGAGAAGATACAAGATTTTGCATGAATTTTTTTGAGTATTTTTATCATCCTTAAAATTTCAGATCAAAAGAATGTCCTTCTGTAGCAGCTAATTAAAATTTGAATGGAACAACAGAAAACAGTAATTAATTAGCAAAAGATAAGCCAAGTGTATGCATTTATGGAATATTTTGTCCTTACTATCACAACTAAGCAGAAAAAAATGACTGGGTAAATGATTTAAAAGCCACTAAATACATGGCAGCACCCAAAGAAAAATTCACATAGAGTTTACTTGATGACTTTAACAATATTTAATCTAGTAACAAGCAGTTAGAAAAATTATACGAGCAAATCTCTCAGTAAAAGGTAGTACCTAAGAACCAAAACACAAATAGCAATAACAATAACTCTGTGGATTAAGTAACTCCAATTTCTAAGAATGAGCCTTCTCCAAAAGAAAAATTAAATATGTAATTAGCTAATATAGATAAGATTTAAGATAATAAAATGACATAGAACACAGCAAACATTCTTTTAGATTTATACGACGATGATAGTATTGTAGATAGAAATGATATTTTGATGTTAGATCCAATAAATGAGCTAGAAGAAAAACACACGAATTCTAAAGGCAGTGACTCCAATCTCTAAGGTAGAACTAGTAAAGTAGATAAATCAAATAAAAAGATATCTTATTCCCCAAAAAGCAAGACTATGGTAAACTTAGAGTAAAAAGAGACAAAGAAAAAAACTTAAAATCCTCCAAACAAAAATGATCAAAATACTCCAGTAAATTAAGAATTTAAAAACTAAGGCGATTTATCAAACAAAAACATCGATATCCAAGTTGCAGAATTAAAGATAAAGCAAGAATAAAATTAAAATAAAAAGTCTAAAAAAAATAATGAATACTAATTTTAAGACATAAGACACAGTTCTAACAGTCTTAATAATCCAGACACAAAATCAAAGAGCGAATTAGATATAACAAAACAAACTTCAAAATACACTGATTTGAGCTCCAATGATGAGTATCTTAAAGATTTTACAGATGTTAATACCCAAAAATACAGTAACAAGGTTTATTATTATAAGTAAGACTTAGGTCATGAAAGTTCTACAGTCGAATTTAAAAACTACTAGAAGATATCCTCATGTAAAATCTAAAAAGACATGATCGCTATATTAAAATTGCAAGAATATGGTTAATATATTTGCGGTTTCTTAAACCACAAAGGAGGAACAATGTATATAGGTGTGCATGATGAAGGTTGGGTAGATGGTATAAGCTTGAATGCTAAGTAAAAGGATTGGTTTAATTTGTATATAGATTATATAACTTCTTTAATAGAACCAAGATTAGTAGTGGGAGAAGTGAGAATCAACTATACTGAAGTAATTGGAAAGCCTGTGTAGCTTAGTAAAGACTGTAAAAATTATGTAATCGAGCTATAAGTAGTAAAAACTAACTATTCAGATATATATTTCTTTGAGAATAATGCATATATTAAAAAATAATCTTCGAATGCCAAAATGTCAATACAAGAAATAAAATAAGACTTATAAGTTAAAATAAAAAAGCAACTCAGAGCAGAGTGCAACCAAATCTAAAAAATGTTTCTATATGATGATTTGAGCGATTTAGATTCTTAAAATTTAAAATAATTGTAAAAATTAGAAGAAAAGCTTAAGTATGTATTAAACTAGGTTTAGATAAAAATAGAAGAAAAGAAATAAGAAAATTGAAACAATTAATCTAATTCTTTCAACATTATTTCAAAAAATTTAAAATGATTAAAAGCTACCTACAAACTATATATTAATATTTTGTCATAAAATTTAAATATGAATAAATGTAATCTGCGTTATGGCAAACAGATTTTTCTTGCTTGATACATTTATTTTTGACTTAAACTAAAGAGTGACTAAATATCATACAAATAAGTGAATTAGTTAATTATTAGTGTTTAAGTTAATAGTAAATAAATTTTTACAAATACTAATAGAGATGGATAGATTATTTTAATTACACTACTTTTATATCAAACGAGCTTGCTACTTAATGAATGAGCGATTTAGTGAAGGAAATCTAAAGGTAAAATAAATTGAAAAATCATCTTAAATGAAAACTAAATAAACTCAAACTTAATTTAAAACTTTCAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,506.3 L-21,750.8 L-31,468.5 S-0828.4 S-3942.2
S-61,061.5 S-9791.1 S-12918.1 S-151,062.6 S-241,133.0
C-0797.7 C-2921.1 C-42,530.6 C-61,686.4 C-81,519.7
C-102,057.3 C-121,517.7 C-141,063.7 C-16964.2 C-18721.3