Summary
Transcript IDgene_000010453
Gene IDTTHERM_00101270
Length1969 bp
Sequence
AAAAATTAGTAACACGAATTAATAATTTCAATAAGTAGCTCGAATAGTAAAGATCCTAGCACAGAATAGGCATTTAAATAACAAGTCAGATCATATAAATTTGGTAATATCATGAACAATCTCAAGCAAACTGATGAATTTATGACTGAGCAATAGCAAAATTAATTGGAAAATTCAATGAAGGACCTGCTTGAAAAGATACTCACTTATATGGAGAAATTTATCAAGACAAAAGATGATTTATAGGCAATCGAATCGAAACTGAATGATTACGATAACTTGAATTCTCTCTTGGACATTATAAAATCTATATTTTCCCATCTAACTGCTAAAATTGATGAGTACTTGCCAAATAGGGATAAAGCATAGTAAAAGACTACCAATGAAAACAATGAAGACTATGACTAGCTTGAAAAAATATTATAAAAGCATGAAGCCGAAATTAGAACTCATATAAGACTTGAATAGTAATTAAAGCTGTACGCAGAAAACTTACAATCAAAATTAGATGAAAGCGAGCAAGCACGTAGCGATTTACTCGAGTCAACAAAGGCTATGATCAATGACATAAAAAGGTAGAATAATGCTTTAAGTGAATAACTGTCAAAACTTTAGCAAGAAAACTAGGCTTTAACAGAATAAGTAAAGGGATTTAACGAAAACGAAAAATTATTAGAAGAAAAGCTATATAATATGCCATATTTGCAACAAAAAATCCAAACGCTAGAGAAATTAGTCAAGGACAATATGCAAGAAAAATATCTGACAGCTTCCATGTAAAATCTTCAAAAAGAAAATAGTTTTAAAAAGGTAATTGCTTAAAATGAGCAAGATCTAAAGAAAGTTAAAAAACCTGAAACACCTCCAATAAATTAAATGATGACAAATAGTGCTATTTAAGGCACTTCTCCTATTAAGGTAGAAAGACGTGCTCCAACTCCAAATCTGAATTCATAAGGAAAAGTTATTAAAGAAAATAGCATAAAGGCAAGTTACCAGAGATTCTACAACAACATTAAGATGAACAGAGAGGACTAGACGACATCATCAACCCTTGCTTTTTAAAATGATAAAAGTGAAAATAAAATAGAATAAAAAAACAAAGAAATCAGAGCCCAAACAATCTATGCAAACATCGCTTAAAAGAATGGAATCAACCAATTAATTTAATCTTCTCTTCGTGAAAGAGACGCTAAGACCCTGAACAGTGGTGGAGGCAGTATTACCAACTCTCATAATAATTCAATAATATGCAATAATAGCAATTCAAGTAAAAATTTTAAACAAACAAACCACAAAAGATCTAAGAGTCACTAAGTTAATAAAATAAGAGGCATGGTAAATGGAAATATAGCCTTAAAAAACCCAACTGATTACTCACGCTTATCTAACCAAGACTTTTCTGATATTCAAATTACAACTGGCTACAACAAATGAGAAAAAATTAAGGCTAAAAATAATAAAAACTATTGAATGTAAAAAAAACTAAATAAAGCTTATATAAATTGAAATATACCTATTACACACATACGTAAAAACATAAACATCTACTCTCTCCATAGAATTCACAAACAAATTAATTACTAATCATCGCTAGTCTGAAAATTTAGATTTTTTCTAAAGCCAATTATTTATTAATGATAAAACAATACCCATTTTTCTAATAATAAGATAATTAATAAACTAGTTTTGTTTGAGAGAAGTTATTTAGAAACTCTTCTCTTCCTTATAATATCTTTCAAATCTAATAAAATACTTTGTCTATACTTAATAATAATTTACCAAAATAATGATTGGGACACAACTGATTGATGATTATATTTCTTCTTAAAATTAATAATGTAAACACAACTTACAATAAATAATATAAAAAAACAAACAAACAAACATATATCCACAAACAAAGATATACAAGCAAGCAATAAAATAAACAAAAAAATAATAAACCAGATAAGGAAGTAAGTAAATG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,572.2 L-21,902.0 L-31,719.9 S-01,328.6 S-31,611.3
S-62,017.4 S-92,391.8 S-122,654.4 S-151,905.4 S-242,373.4
C-02,525.6 C-210,301.0 C-43,606.7 C-62,058.3 C-82,633.4
C-101,518.8 C-122,785.5 C-144,176.0 C-163,465.7 C-182,811.5