Summary
Transcript IDgene_000010494
Gene IDTTHERM_00105320
Length1449 bp
Sequence
AAAGATAAAAAAATAAATAATATTCATCAAAGCAAAGAAATAAATAAATTAAATAAATATAAAAATTATTAAGTAAATGGTTTACTTTTTGGTTGGTGCTGAAAATCTTTTTGGTGATAGTGATAAAACCTTTTCAAGAATCACCACAGAATTAGGCAACTTGGCTACCATTAAGAATAGGATTGATGTTCAAATAAGGGATTTCAAGTTGAGCAATGTTGATTAGTTAATTTCTTCCAATGAAGCTATGCTTAAAATGGAAACACACATTGAAAGTATCTTGAAGAAAATCGAAAGAACATATATGGATATTACTGAATCTCAACACGCTGAATTCCAAGTTAATACTAGAAGTAGTTCTGTTTCCTTGAGTCAATATGTTCAAGATTTTAAGTGGGATAATAATATTTTCTCCAGAAGTTAACCTTTAATGGAATTGTTGAAGAGTTTCTAACAAAAAGCAACTACCATTGATAACGATATTCGTTAAAAGCAACAAGTTCTTTAAGAAGCCAAAAATAACTTGAACAGTGTCGCCCTCAAAGAAGGAAACTTATTGGTTAAGGATTTGAGTGATGTTTTTAGAAAAGAATATGTCAAGGAAAAGGATTTCATTTATACTGAAAATTTAACTACTGTAGTAGCTATTGTTCCCAACAATGTTTTAGAACACTTTTAATAACAATATGAATTGATGCACCACTGTGTTGTCCCTGGATCTGCCAAGTAATTTGAAGGCATTTAAGACAAAGACTATACCGTTTGGAGAATCGTTATATTTAAATTAGACTATAAGAATTTAAAGAAGATTTTATTAGAAGGCGAAAAGCTTGATGAAAATGGCAAGCGCCAAAAAACTCCTGTAGAAGAATTCATTTCTGCAAGCAGAGAAAAGCTAAAAGTCACTGTTAAGGAATTTTAATATAATGAAAACGACTGTGCTGAAAGAGAAAGACAAAGAACAGCCTTCTAGACTCAAGCTAATAGTTAAAGCGGAAAATTAAGACAAACTTGTGAAAAGAGTTTTGGTAATCTTTATGAAGTTTATATCCACCTTAAATTCCTTAGACTTGTTGTTGAAATAGCTGCCAAATTCGGTTAGAAATCTAACAATACTACTTGTTTGATTCAACCTGCTCCAGGAAAAGAAAAATAAGTCCAACAAAAGTTGTTAAAGCTTTTTGCAGACCGTGCTTAATTGGATGCTGGTATGTACGGTACTAAGGAAGAATTAGAAGATACTGAAGATTTCTTCCCTTATGCTTATGTTCCCATTACTGTCTGAGAAAGATCATACATACATAAATTAATTCTTTTAGAAGATATTTATTATAGAATCAGTTTATGAAAAAAGAAAGGCTGACTCAAATAATTATAAATAACTTAATTTGTTGCTTTAGCAATTATTTTTATATATTCTTACAGGTATTTGTGTTTTTTAGTTAGTTC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-116,640.2 L-214,625.6 L-315,754.0 S-010,011.0 S-37,714.4
S-68,896.2 S-98,677.9 S-128,186.7 S-159,051.9 S-2410,090.8
C-07,798.9 C-211,543.1 C-45,165.6 C-66,171.6 C-86,017.6
C-109,098.2 C-128,968.8 C-149,248.0 C-168,523.0 C-187,523.7