Summary
Transcript IDgene_000010496
Gene IDTTHERM_00105430
Length681 bp
Sequence
AAAAATAATATCTTTAGTAAATAAAAATCTAAAAAGAAAAAAAAAGTTTAAGAAAATCAAAAATAAAGAAATACAATTAAAATGTCTGGTTGGGATCAATATATCTAATATCTTTTGGCTGATAAGAAGTGCGAATCTGCCTACATCCTCGGTAAGGATCATGCTAACATTTGGGCTTGCTCTACTGGTATTGCTGCTCTTCCTACTTACTAAATCAATGTCGAAGGTAAAAACTTCAATGTTAACGAAGCTGAGCTCTTGGTTAAGGCTTTGAAGAACAACGGTGTTCCCACTGATCCTAATGTTGGTTTAAGAATTAAGAATGAAAAGTACTACACTGTCAGATTCGACGCTGATGCTGGTACCTGGTATCTTAAGAAGGATTAAGGTGGTGCTTGCATTGCCGTTACCAAGTAAGCTTTAGTTATTGGTACTTTCAAAAACGACATCAAAATGACTAACGGTCAACCTCAAAATCCTGGTGCCGTCAACGCTGCTTGTGAAAAGCTCGCTGAATCCTTAAAGTCCGCTAACTACTGATTTGATTATTAATAGTTAAATAAATGATAATAAATTTATAAAAATAATTTAAATTGATAAACTTGTCATGATGATTTTTGTGTGATTTCATAGAAATATTATTCATTCATTTAGCTTTTTTTTAGATTATTCTTCTCAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-132,204.8 L-235,740.3 L-335,092.6 S-015,295.4 S-312,627.0
S-612,829.4 S-915,598.2 S-1214,214.0 S-1514,581.7 S-2410,408.8
C-06,606.8 C-26,535.8 C-45,288.9 C-610,629.9 C-814,542.7
C-1017,411.8 C-1213,349.3 C-1410,910.3 C-1612,740.0 C-1812,931.7