Summary
Transcript IDgene_000010512
Gene IDTTHERM_00106960
Length1043 bp
Sequence
TTCGAATCTAATCAAATAAAAATAAAAAAGCAAATAAATATATTTTTTATATATTTAAAGCAAGAAAAACAATCTAAATCATTAATAAAAACTCAAATACAATAAATATAAGTTAGTTTTAGTAGCAATCAAAATGAGCGGATCAGAAACCCAAATTACAGTTTTTTCACCTGAAGGAAGACTCTTCTAAGTAGAATATGCTTAAAGAGCTGTTAAAAACTCTGGTATCACTACTATTGGTGTCAGAGGTAAGGATTGTGTTGTTTTAATTACCGAAAAGAAGACCTAAGAAAGTTATGTAGATATGAATTCCTTCACTAATATTCACACCGTAAGCGAACGTGTTGGTGCTGCTACCACCGGTTATTACCCTGACTCTAAAGCCATTGTAACCAGACTTAGATAGGAAGCCAGTGAATATAAGCTTAAAAATGGTCACTTCATGCCTGTTGATTAGCTCTCTTGCAGATTAGGTGATTTATCCTAAGTTTATACTCAAAAGGCTTTCATGAGACCTTACGCTGTTGAAACTATTCTTGCTGGATATGACAACGAATTAGGTCCTTTACTTTATAAGAACGATCCTTCTGGTTACTTCTGTGGTTACAGAGCTGTTGCATCAGGTATTAAGGAACAAGATGCTATCCATTAATTAGAAAAGGAATTTAAAAAAGATAAGAACGCCACTTCCATGAGCTTTGATAAAACTATAGAAGTTGCCATCAATACTTTAAAAAATATTCTTAACCGTGAATTCAATCCTACTGATATTGAAATTGGTGTTGTAAGTAAAGAATAACCTAAATTCAAAAAGCTTAACGAATAAGAAATCGAAGAAGCTCTCAGAAGAACTAACCAATCAAAGTAATGAAGAAAAAACTTAGCAAACAAATAGGATAAAAGATAAAGCTTAAATAAATAAATTAATGTACGTGTTAATTAACCAATCTAAATTTTTAAACCAAATTATTATTTTCTCTATGTTCATTTTATGCCCTGCTTTGTATTTTTATAAATTTTAATATCATTAAAATCCATCATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-117,469.7 L-216,527.8 L-316,193.0 S-022,232.7 S-313,531.7
S-612,190.7 S-910,572.2 S-1212,738.7 S-1513,212.2 S-2413,021.0
C-04,279.9 C-24,769.5 C-45,910.9 C-63,901.9 C-85,517.2
C-107,173.8 C-127,075.5 C-147,903.6 C-169,602.1 C-188,137.2