Summary
Transcript IDgene_000010537
Gene IDTTHERM_00551090
Length1504 bp
Sequence
TGCTTTTTATATAAAACAAATCATTTCAAATAAGAAATTTAGAGAAAAACTAAAGCAAACCTATTCATAAAGAATATCAAAAAAATAAAAGTTTTTTAGTAATTAAATCAGATGTCAGTAAGTTAAGGTGCAGGATTGAAGGCATTTTATCTTTCTAAGATTGAAGAGCTCTCTTTGAAAGTTAATGAAAAGTCATAGAATATAAAACGTTTGGAGGCTTAAAGAAACGAATATAATAATCAAGTTCGTATGCTCAAAGAAGAATTTTACTCTTTATAATCACCTCACTCTTATGTTGGTGAAGTTGTTAAGCCAATGGGAAAGAGCAAAGTTTTAGTTAAGATATCTCCTGATGGCAAATATGTAGTTAATATAGATAAAAGCATTAAAATTGAAGATTGTTTACCAAATACTCGTGTTGCTTTAAAAGGTGACTCTTATGTTCTTCACAAGCTTCTTCCCACTAAGGTTGATCCTTTGGTTTCTCTCATGAAAGTCGAAAAGGTACCCGATTCTACTTATGATATGATCGGTGGTCTTGATCAATAAGTTAAGGAAGTAAAGGAAGTTATTGAATTGCCAATTAAGCATCCTGAAATTTTTGAGTCTCTTGGTATTGCTTAACCTAAGGGTGTTCTCCTTTACGGACCTCCTGGTACTGGTAAAACCCTTCTCGCCAGAGCTATTGCACATCATACAGATTGTACTTTTATTAGAGTTTCTGGTAGTGAATTGGTTTAGAAATATATTGGTGAAGGAGCAAGAATGGTCAGAGAATTATTCGTCATGGCTAGATAACATGCTCCTTGTTTGATTTTTATTGATGAAGTCGATTCTATCGGTGGTGCAAGAATTGATAGTGATAGAGGTGGTGACTCAGAAGTACAAAGAACTATGCTTGAACTTCTTAACTAACTTGACGGTTTTGAATCTACAAATAACATTAAAATTATCATGGCTACTAATCGTATTGATATATTAGATCCTGCTCTTCTTAGACCAGGTCGTATCGATAGAAAGGTAGAGTTCCCTAATCCTAGTGTTGAGGCTAGATTAGAAATCTTATCAATCCACTCAAAGAAAATGAATCTCATGAGAGGTATTAATTTAAAGGCTATAGCTGAAAAGATGGGAGGAGCTTCTGGTGCAGAATCAAAGGCTGTATGTACTGAAGCTGGTATGTTTGCATTAAGAGAAAGAAGAATTCATGTTACTCAAGAAGATTTCGAAATGGCTGTTTCAAAGGTTATGAAAAAGGACTTAGAAAAAAATATGGCTCTTCGTAAATTATGGACATGATCAATTATTAATAAAATATTTTATCTAATAATTTTTTGAATGCAAAATTAACTAGCTAATAATTTAATAATGAAAATAAAGCAACTTGGAATAATTAATTTAGATTATTTATATAAATCTATCAAAGCATATTAGTTTTACAATCTTTGTTTATATCTTGTAAACAACACTCTTCTTTTTATAGTCCAATTAATTACCAAAATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-111,269.7 L-210,598.0 L-311,449.3 S-018,947.2 S-39,438.7
S-67,883.7 S-96,211.5 S-127,342.8 S-158,456.8 S-247,537.9
C-04,654.3 C-23,860.3 C-43,446.5 C-62,903.6 C-87,273.7
C-109,690.9 C-127,891.9 C-145,108.8 C-165,456.6 C-185,098.5