Summary
Transcript IDgene_000010613
Gene IDTTHERM_00633390
Length4061 bp
Sequence
AAAGAACAGGATGTTAGTTGAGTAATAGAAATATGAAAAAGAAATTTAAGAGAAGAAAAGATAGTAAGACATGTTGACAAAATTTTGCGAATTAAGTGTTGCTGGAGCAGAGGAAGGAAGAAAGATTTATATTGCTCAAGAGAAAGAAAAGATAGTTGTTAGGAATAGAATTGAGAAGGAAAACCAGATTTAAAAGGAAAGAATGGATTATTTTGACTAAAAGCATGAAGAATTTAGGGAAAAAGCAATCGCAGAAGAAATAGAAAGAAAGAAATAATGGAAACTGCAAAAAGTAGAATACATGGAACTTAATCTCTAGAATAAAATATAAAAAAGGAAAAAACATAGTAAGACTTGTCAAGACTTAATTGATATCATTCTTGATGTCACTGAGCTCTGCCACAATGCTTAGAGATAAAATAATTCAATAAGAGTTCCAGAGTAGTATTGGAGAGATCTGATGGAAAGATTTGCAGAAGGAAGACCACTCTGTGAAGAAAAGGTTGTGACAATATTTGAATAATAATAACAAACATAACGTCAAGCTCACGAAGCTGAAATCTCGGAAGAGCTTGATTAACAGTTATCTATGATGTTTACTGATTACAACCTAGGTTTCTAGATGTGGTAACCTTTTCATTAATTTGAATAGCCAGAAAATCAAATTTTAAATCATGCCTACAATGATGATCAGCTTGGAGATTTCTTGCATTAAGTTATTGACAAAATATATCCTTAAAAAGCTATTTAATCAAAGCCTCATGACATTCCTGATCACATGCCTTTGAGAATCAGCATTATTGGTAATAGATTTTCAGGAAAGAAATCCCTTTCTTAATTAATTAAGTAAAAATATGGAGTTGAAATCATCGACGTATATGATGTTATAGATCAGGCTATTAAATATGCTTTTCCTCCTCCTGAAGATGAAAATGAAAAAAAGAAAAATGCAGCAAAGAAATAAACTAAAAAAGGGTAAGTTGAAGAAGAAAAACCCGATAATCCTCAACTCAGAGAACTTGGATAATAAGCAAACGAAATGAAAACATAAAATATTCCTTATACTGATGAGATTTTAGTGAGGGCTGCTCTTATATAAATAAAATAAATTTTCCCTGTGGTAACACCTGATTAACTCATTCAATAATTAGCAGATGCTAAGATAAAAGAGTAAGAAAGACAAGCTTAAATGAAGAAAGAGTGGGAAGACTACTTAAAAAAGAAAGAAAAAAGTAATCCTAAAAAAGCTGCAGGAAAAGAAGGCAAAAAGAATGTAGGTTCTAAAGTAGAAATAGAAGTAATAGAAGACCCTCCTCAAGAAACTTACGAAGAAGCAGTTTATCGTTTAATGAATCAAAAAGAATTTGAATACACACCAGGCTTTGTGCTGGTTAACTTCCCTCAAAATGTTAAGTAGGCCAAGCTTTTAGAAGAGGGTTTAACAGGATTTGTGATGGAAGAAGAAAGATTGAATCCAGAAGGTGAATAGATAAAAGAATAAATAGCTTAACTTGTTAGAGCAGGAGAGAAGACTCCTGACACCAGTCTTAAATAAGGCGGAATCGATTTGGTGATAAATCTTAATGTCGATGAGACTATTGCAGAAAAGAGAGCGGCAAATAGAAGATTAGATCCTTAAACAGGAAATATATATAATTTAGAAGATAATCTTCCTCCTCTTGAAGAAAAAGGACTTGCTGATAGAATACAGCCAATAGATGATCCTTAAAGCAGCTTAGAAAAAATATAAGAAGCCAACAAATAATTCATTGAAAACTTAGATTATTTGCAAGAATGGTATGGTATGTTCGGATTTGAGACAGAACCTGCTAGCAATTTAAATACAGAGCAATAACAGCCTTAATCATAAGCATAATTATAGTAGAATGAAGATTTGGCATAAGAGCAACAGGAATAGGAAAAAAATATATTTGGAGCTATTTAAAGTTTGGAGTCTACAACTAAAAGAATTGAGGTCTTTGAATAAATAGACAAGAAGCTATCTGATCTGCTTAAAATTAAAAAGAAAAAAATAGAAGAGTAAATCTAAAACTACTAACAAGAATAAGAAAGATTGTAGTAGTAAAGAGAAGAAGAGAGACTCCTTTAAGAAAAGCTAGAATAAGAAAGATTAGAAAAAGAAAAACAATAGCAATAACAATTATAAGAAGCATCTAATTCAGCTAACACTTAATCTAACAATCCTAATGCTTCAGCCTCCCAAGAATAATTGTCAAGTCAAAACAAAATCCCTACTGATAATCTAATTAGTAACGACATGGCTGACACTTCTAAAATAAACTAAACAGATCAATCTATGTAAAACTCAGGATAAGCAGGAGGTGACTTCTTTGACAGACTTAAAATGGACAATTTGAAAACTGTGATGAAAATGTGGAACGAAATATAGACTAACTATTTCAAAGAAATAAAATAAAGCTTACATAAAATAGATAACCATAGAGAGGTTATTTCAAATCGTTTAGCTGATGTATAATTTAGATTCCTTTCGGTTATTCAAAGGCCAGATGATAAATAGCATAAAATAAATACTTTCAAAGACAACCTAAATAAATTCTTTGATGATAATCCACAAATGCTTAGATTCTAAAACACTAAAGATGAATTAAATCAGCACTTAGAAACTTTGTATGAAAATCTATGGGATTCTGTAGAATAAAAAAAAGCTGAATCAATTTAGGAAAGAAAAACAATCATGGCTTCAGGATGGTTTGACTCTGAAATGGCTGCTCTTTTTTCTTCTTATTAAAGATTTTTCTAGCTAGAATTAAATAAGCTTGAAGAAATTATAGAACTCATTTTATATATCTAAGATGTTGTAGAAGGAAAACCCATTAATGAAGTTTAAGAACATATCATTTTAGATCCCTTCCCTAATGGGCAACCTCCACCAATTTATGATATTGAAAATCCTAACCATTTCCCTAGGGTAGAGAAAATGTTTGATCACTTTATGCATTCAGTTGATAACATCAGCGAGCTTATTGGAGACATAAGAGCTAAATTCTTTAAAAAGAGAACTGCTGGTCTATCGTTTTAGACTATAAACGAGAAGTCCTATCCAGGCTTGAACGATCTCTATAATTAAGTACTCGAAACTGAAAAAGGAATTTGCAAGTATAGAGGATACATTTTGAAATTTACATTAATTAGTAGAATTAAGGAACTTAAAATGATTGAAGTAGCTCTGTACAGCAAATTAGATGATTGGATTATATTTGGTTTAAAGCATGAAAACGAAGTTATTTATGATGCAGTCAGAACTTTGAGATAAGCTATTCAATCTTAAAACCCTGTAGACACTTTGGTTGTGAGTGTTAAAAATATTTCTGACACATACAAAATATTGAATTGCTTCAATCAAATTCCTGCTTATATTCAACCACTCGAACTAGTTGAATCGGTTGATGACTTTAGATTCACAATTTTCGGTATTAAGCTTCTTTATGAAGAACTTCACACTTTATGTGATAAAAGAGACATCATAAATCTAAAAATATTTGAAAATGTATTCTTAAGAAGAAAAAAACATTCAAATCACCTCCCAAAATTCATAAAGTAATTGCCTGATAAATGTTTAGAGAGCATTTATGCAAACTTTGAATCACAAATACATGACGATAAAATAGATTTTAAGGACTTAATGATTTGTTTCATTCTGTTTAGCTCTCCAGTTCCAACTGAAGACCTCATAGAAGAATACAAAGATCAACTATTGACCTACTCAAACAGTGGTTATTTAGAAACACATAATTTCCTTCGTATCGAAGCATGGTTTGACGAATATGAGAGAGATAGACAACTTTATGGTTAGAATTTATTCAACAGAGTATTTTTTGTAAAGCAGCTTTTGTTTGATCTCTATTGCGAAAATGAACCCTACATCCTAAGCATTAATTAATACATTGAGTCTCTCAAGAGATTGTCTAGTAAGGGCAAAGAATATTTCTGGCAAATTCTTTTTGAGTGAAATTTTAATTGAAAGATTTCATAAAATAAAGTCATTAAATTATTAATAACATTAAAAAAATCAATAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,032.7 L-21,073.1 L-31,114.7 S-0743.2 S-3655.8
S-6443.2 S-9405.9 S-12468.8 S-15502.3 S-24583.8
C-0538.2 C-2412.5 C-4405.0 C-6452.8 C-8898.2
C-101,367.7 C-121,030.0 C-141,101.7 C-161,234.2 C-181,182.5