Summary
Transcript IDgene_000010701
Gene IDTTHERM_00641240
Length1034 bp
Sequence
AATATTAAATAAAATCAATAAAATAAGTAATAAATACATCATAAAAATGATCGGAACTTTCTTCAATCGTTTCTCTAAAAATTTGCACTCTATTAGCAAATACAATTTTACAAGCAACCCTGAAGCCAAATACAAGATTGTCCTTTTGAGACACGGTGAATCTGTTTGGAATAAGGAAAATCGTTTCACCGGCTGGAAGGATGTCCAACTCTCTCCTAAAGGTATTGAAGAAGCCAGATCTGCTGGTAAGACCTTAAAGCAAAACGGTTACGAATTCGATGTTGTTTACACCTCTGTTTTGACCAGAGCTATCATGACTTATAATAACTTAGCTGATGAATTAGGTTGCCACCATTTACCAGTTATTAAACACTGGAGACTCAATGAAAGACATTATGGTGCTCTCTAAGGTTTAAATAAGACTGAAACTGCTGAAAAGCACGGTGAAGAACAAGTTAAAATATGGAGAAGATCTTACTCAACTCCTCCTCCTGCCCTTGAACTCGATGATGAAAGATTCCCTGGACACGATAAGAGATACAAGCACCTCCCCATTCAAGCTTTACCTAGAACTGAAGCTTTATCTGACTGTGTTGCAAGAGTTATTCCTTTCTGGTATGATTAAATTGTTCCTTCTGTCTTAGCCGGTAAAAACGTTTTAGTTGTTGCCCACGGTAACTCTCTCAGATCTATCGTTAAGCATGTTGATAATGTTTCTGAATAAGATATTATTGGTATTAACATCCCTACCAGTGTTCCTTTAATTTATGAATTCGATGCTAACTTCAAGCCTATCAGAAACTACTACTTAGCTGATCCTGAAGAATTAAAGAAGAAATAAGAAGCTGTTTAGAACTAGGGTAAGAAGAAATGAATAGTTAAAAATATTAGTGAATAAAGATGAGTATTTCAGTTATACAAATAATTTTAGGAGTAACTAGCTAAACTTAGTAGATTAAAATTAAAAATATTTTAATTTAGTCGTAAATATATTTTTTATGTTGTCTGCAAATTAAAAATTAGTTGGTAGCTCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-145,534.4 L-246,511.9 L-349,347.0 S-041,179.9 S-318,606.5
S-616,424.8 S-916,727.3 S-1216,585.9 S-1517,819.0 S-2412,994.3
C-06,488.7 C-23,523.3 C-46,070.0 C-65,569.7 C-814,575.5
C-1017,257.9 C-1212,240.0 C-149,988.4 C-1610,783.9 C-1810,648.6