Summary
Transcript IDgene_000010787
Gene IDTTHERM_00666640
Length1151 bp
Sequence
AATAAAAACATTAAAAATCTTCAAAATCATAAAAAGTACATATTTATTTTATAACGTTAAAAAAATGCTCTTCACTAAAAGTATAGCTAAGTTCTCCTCAGCAGCTAATGTTAAAAACTTCGCAGTCGTTGGTGCTGGTCAAATGGGTACTGGTATTGCAATCGTTGCCAACAAGATTGGTGGTTTGAATGTCAAGATTGTTGACTCCACTGAAAAGGCTCTCTCTGGCAGCAGAAAGTTCACTGAAAGCTGGTGTGACAAGGAAATTGCTAAAAATCGTATGACCAGCGAAGAAAAGCACTAAATGCTCTCTCGTTTCTCTTACTTCACAAAGCTTGAAGATTTAAACGATGCTGACTTTGTTGTCGAAGCTGTCACAGAAAAGTTTGAAGTCAAGAAAAATATCTTCACCACTTTGGATCAAATTACCAAGCCTGATACTATTTTGGCTTCCAACACCTCCTCCATTTCTTTGACCAAAATTGCTGCAACCACCAAGCGTCCTGAAAAGGTTATTGGTATGCACTTCATGAACCCCGTCCCAGTCATGAAGCTCATTGAAATCATTAAAGGTCTTCAAACTTCCGATGAAACTCTTTAAACCACCTTAGACTTATCTCATAAATTGGGTAAGACCACTGTTTTGGCTAATGATATTCCGGGTTTCATCCTTAACAGAACTTTAATGCCATACATCAACGAAGCTGTTTATGCTTTGTTTGAAGGTGTAGCTACTGTTGCTGATATTGATTAGGCCATGAAGCTTGGTACTAACGTTCCTATGGGTCCCCTCACTTTGGCTGATTTCATCGGTTTGGACACCTGTTTATTGATCATGTAAGTCTTACATACTGAATTGGGTGATTCTAAGTACAGACCTTGCCCCTTGCTCGTTAACTACGTTAATGCTGGCTACTTAGGAAAGAAGAGTGGTAGAGGTTTCTACAAATACTGATCTATTTTAATATTTATTAACAAATATATATATGCCTTTTTATTCTAAGCGACAAACAACATTATTACGAGAAATAAATTTAATATTTGCTAAAACTTCGAAAGAAGTGAATTAATTCATTTATTGTAAATTAGAATATTTATGGTGTATGTATCAATGTATTCATTTTATTACTAAAATATTTTTTCACTACCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-138,149.3 L-239,327.7 L-356,380.7 S-019,956.9 S-36,082.8
S-62,458.8 S-93,155.2 S-123,199.3 S-153,964.9 S-241,713.7
C-0993.5 C-23,342.4 C-43,762.6 C-61,331.6 C-82,923.3
C-106,947.6 C-125,163.0 C-144,583.1 C-162,627.2 C-181,639.5