Summary
Transcript IDgene_000010792
Gene IDTTHERM_00666680
Length2359 bp
Sequence
ATAAATAACAAATTTAGAAAATAAATATCAAAGCATAATTTAAAAGCTTAAAAATCTAGCAAATGGACGTAGAAAACAGTCAATACTTTTTGAGTTAATAATTTGCAGTTCACACTTAAGGTGCTCGTTGCGTTGATGTGAATAATAATGTGTTAATTAGCGGTTCAACAGATAAAACTGTCAAAATTTATTCTTTTATAGATAATAAATATGAAATGATATCCGATGTTAATTTCTTTGATGACTATGTCTACTCTGTCAAGGTTAATCTCAAAGGAGATGGATTTTTCGTAGGTTCTAAAGATACTCACATTTACGTTTTAGATATAACTGGCAGTCCTTCTACAACTTTATCTGGCCATACAGGACCAGTTTGTAGTTTTTCCCAAATAGACAACGATACTTTAGTTAGCGGAAGTTGGGATGGAACTGCAAGAATTTGGGATCTTAGAGAAGGCAAAGAAGTTAGAAAGTTTGAAGGTCACTCCCATGCAGTTACTGTATTGGGTGTTATGCATTTAGACTTATTAGTTACAGGTTCTTAAGATAAGAATCTTAACTTTTTCAGAATCAGCACAGGTGAAAAGATTAGAACAGTTAAAGAAGCTCATACTGATATTATTAGACAAATAGCTTTTATTGAAGATGTTGGTTTTTTGAGTGCTTCAAATGATGAATTATTAAAATTATGGACATTTGATGGTGATTTGATGTAATAATTAACTGGACACACTGCTTTCGTATTTACATGCGCTTGTTTAAGTTTTGGAAAATATGTTTCTGGAAGTGATGACTAATCTATCAAAATATGGAATGATTCAACTAACATCCAATCTATTTTGCATCCAGGTACTGTTTGGAGTGTAACAGTTAATAATAGAAACCATGACATTATCACTGCTTGCTCTGATGGTTCAGTTAGAGTTTTTACAACTGATCCTTCAAGAAAAGCACCAGCTATAGAAATTGAAGATTTTGAGAAAAATGCTACTGTTTCTAATGCCAAAGGTCCCTAAGGACTTCCTCCCGATGAGTTAGCAAAGCTTCCTGATGTAAGCTAATTAAATTAATTCCAAGGAAAGAAAGAAGGCGAGCTTAAAATTTTCAAAAACGGAGGAGTTCCTGAAGCATATTCATGGAAATAAGCAGAATAAAGATGGGAAAAAATTGGTGAAGTTTTGTCAACTATTCCTAAAAAAACTTATCACGGAGATGAATTTTTCGCCGCAGGAGATTATGATTATATTTTTGATGTAGAAGATGATAGCGGATTCACAAAGAGCATTCCTTTTAATGAAGGTGATAATCCTATGGAAGCAGCAGAAAAATATTGTGCAAGAGAAGGAATAAGTAGAGCAAATATTGAGCAAATTAGATAATTCTTAATGAAAAATACTAAATATCATTAAAATTAGGGCAATTAAAAAAAACCATAGTAAAATATTTATGCATAGCAATAGGTTTAGTAATAGAATAAGTCTAGCATTTACTTCCCTCTCAATCAATTTTAATATTATGAATAAAAGAATTTGGAGGGATTAAAAAAGAAGGTGCTTGAATTTAACGAAGCATTAAAGGCTGAAAACCATCCTCTTCACTTGGTGGAAAAGCAAGTAATTTATTTCAACACAATGATTGACATGCTTGAAAAGACAAATATGTATCATACTTCTCGTCTCAACTACAATGAAATGGAAGTATTTACAGTCAAGCTGATTAACTGGCCAAAGTAATATATGCTTCCTATATTTGACTTATTCCGTATATTCGCTCTTCACCCTTAATCTGATGCTCTCTTTAGTGGTGTAGACTCTGGGCTTCATTATTTTACAGTTATTTGCGGAGGTTTGATGTCTGAAGAAAATAACGATGTCACCAAAAATGTTATCTTAAAGATTCTTGTCAACTTATTTAACCAAACTTCAGGACGTTATGGAATCTACAAGCACCATAAGTTTATAATTGAGTGTATTCAGAGATTAAGAGATAACTAGAATGCTAATTTGCAAACTACATTAGCTACTCTTATGTTTAACATCTCTGCTGAATACATCAACAACTAGAATCACTCTGTTGACGCTGTTACTGCTTATGTTAATGAAATAATTTTCTTGATCTAAAAAGAAAAAAATGCTGAAAATCTATTAAAGTATTTAATTGCTTGTGGTAATTTTGCTTTAAAATCTGCCAACACAGCTAAACCACTTATTAAAATTGGTTTATCTTTTTACTAACCTTAGATCAATGATGCTAAAATAAATGAATGCTTAAACGATTTAAAGAGCATTCTATGATTAAATTAATAAATATTATTTATATTTGACATTTTATTGAATCGTATTTCATATTTATTATTCTC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,955.1 L-27,839.9 L-37,989.0 S-011,614.9 S-35,792.1
S-63,694.1 S-93,923.6 S-124,856.7 S-155,141.1 S-245,822.6
C-03,004.6 C-24,110.4 C-43,699.4 C-63,176.7 C-84,153.7
C-103,791.5 C-124,016.9 C-144,102.5 C-164,740.7 C-184,192.4