Summary
Transcript IDgene_000010972
Gene IDTTHERM_00675720
Length111 bp
Sequence
TAAAAAGTAAGATACATACATAGATATTTTAATCATTCATTAGGTAGTTAAAAATTAGATTAAATGATGCTGCTTAACGCCTCTAAAAATAATAGCTAGAAGATAATCAGG