Summary
Transcript IDgene_000011003
Gene IDTTHERM_00703410
Length971 bp
Sequence
CTTTTGACCAAAAAAATCAGAAAGAAGAATTAAATGTAAAAGATAAAACTTTATCTGAAAACTCTTATTTAGAATCACTAAACCAATCTGAAGTTTTTTCTGAAAAATAAAAATAAAATTTATCTGCTAATGCTTAAAAAGTTTAAACTTAGCAAAATCTTGAAAAATAAAATTAATCTGATTTGCAAAAAGAGAAAGAAGACAAATCAAAATAGCAATAACAAGAAGACAAGGATGAATATTATGATGAAGATTTTAAAGATGAAGAAGTTTTATCAAGTCCATAAAATTTAAAGAAACAAGATAAAATAGAAGAAGAGCAAAATGCTGATTATTCGTTTGAAAGTGTGGAGGACAAAGGGACAAAAGAGTAAAGTAAAAACTTAGATTTATCAAATTAAGAGTTAATTGAATCTAAGTTAGTTGAGAAGAAGTAAGAATTTACTGAAGATCAATAAGTAGCAGCTTTAAAAATATAAAAAAACTTCAAGTAGCTAAAAAGCAATTAAGCAAAAGAAGTAATCGTCAAGAAATAATTCTTTTCATTAAGATTAAATGACGATAATGGAGACATTTAACTTGTTTAAGGTGAATGCCATATAACTTTATAAAACAAGAGCTACTTTTTAATATTGCTAAAAAGTGAATCTATTGATGATCTTAATCCTCATATGACATAATAGCAGAAAATAGAATTAGGGAAGTTAAATAAAAAACAAAAGTAGCAACTCTTTTCAAATTTTTCAACACTTGTTAATTGCAATATTGGATTTAATCAAAATCATTTAGTTTTCGAAGACATAAACATGTTCATAAATCCTGAGTCTATACACATTTCTAAAATCATTTTCAGCTGAGTTGAGTATGATGAATGAATTTTTGAATTATTTTGCTTAAAATAAATGAGATATTTATCAAATTTTAAAGAGTAAAAATAAATAAGTAGCTTGTAAATTTGAGAAAAAAATTTC