Summary
Transcript IDgene_000011004
Gene IDTTHERM_00703410
Length656 bp
Sequence
TTTTATTATGTAGAATTAGATAATAAAGATAATATACCTTTAATTACTTCTGTAGTTTAAAAATCTTTAAATTTTTCAATTACTAAAGCTATTGATTATGTTTGCTAATAGGAAAATTAGCACAAAGAGGATAAAAATAATAGTTTAAATGATTAACAATTAAAACTTCAATAGTAGTAATTGCATTAGCAGCAGATATAAACACAATAAAAACAAGAAGAATAAGGTATCCCAGAAGATGAGCTTACAGTAGAGAAAGTTAAATTTATTTAAGGTGCATTCAGAGATAAGAAAGTTAAAGATAAAGCTAAAGAAGATATGATCAAAGCTACTTAAGAGTTCAAATAATAATTATAAAATAGGATTGTCTAATTTGGAAGTCATAAGCTTTTTTTACAGTGTTACAGATAAATTACACCTGAAAAATATATAATTTAAGTTGATTCTCTCAATCCTAAGTAATTAAAATTACCTAAAATTAATGATCAATAGGAAGTAGAAAAAGATTTTATTGAAAAAGTAATGCAATCTGAAAATCCATTTTTTGAGCAACTAATTTATCTCAATGAAGAAAAAGGAAAAATTTTCTTTTAGCAAAATTAATAAAAATAATAATTAGAAAATAAAGATTTTATCAAAAAAGAAGATAGTTAAAA