Summary
Transcript IDgene_000011088
Gene IDTTHERM_00725960
Length629 bp
Sequence
AAATTTTTTAACTAAAAAAGTAGATAACAGCTAAGAATTAACTTAATTTTTAACAGAAACCAAAGTAGTTGATTCTAAAGTTTTTGAAACATTCAAAGCCATGACTGCAAATTAAGATAAAATATTTATTTTCAAGATCCACGGACTTTCTCATTTCTTCTTTACTTATTGCAGATTTTCTGTTTTTGCATTAGCGTTGGCTACTATGGCACATCTTGGATATTACTATGACAAGAAGATGGAAAAATATAAAGAAAATAATTATGAAAATAGATAAAAAAGGTCAAAAATCAATTTTGCTACTGGCGCTTTAGTATTATTTACTATTGGTGGAAATGTTATATCTTTTATTATGGGAAAGAGATATTTAAAGTCAATTAATTACTTGCCAAAAACCAATTAATTTGAATTTAATTTCTATGGGTTAATATGCTAAGACAAGCCCTACAAGGTTGAGCTTAATGAAGTATTTAGAGTTTAAAGAAAGTTGCTTGATTAGACAGTCTAATTCTAAATATAAAATAAAAATTGTCCCCATACTTATTTCTCATCAAAAGGAACTGGTTGGTGGTCAAATAAAAAGCTATTTGAATATATTGTAGATTAAAATAAATTATCAGAAATGCCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,481.7 L-21,068.9 L-3695.3 S-0109.6 S-334.3
S-635.1 S-945.3 S-1251.8 S-1546.9 S-2436.5
C-031.2 C-236.4 C-435.7 C-638.8 C-863.1
C-1065.6 C-1241.4 C-1443.1 C-1635.7 C-1832.2