Summary
Transcript IDgene_000011689
Gene IDTTHERM_00900600
Length319 bp
Sequence
AATTATGATGCTGAATTTAAAAATTTTGTTTATCACAAATAACTTAAATATATTATTGATGGATTAACTAATTTTGTTCCAAAAAATAGAATGACTATTAAGGAGGCTTTAATTATTTTAAAAGGAATTATTTCTATTGAATTTTAGTTAGATGACATGCTTATTGAGACGATAGATGGAAACACTCAGCAGTTTGCAAGTTCACTCAAAAATGAAATTGAGTTTGTTAAAGATTTGTCAAATAAGTTTTACCCTATCATTAAAAACTAGCAGACGTTATAGTAAGAGTTAAAAGAAGACCATCAAAAAAGATAATATG