Summary
Transcript IDgene_000011690
Gene IDTTHERM_00900600
Length173 bp
Sequence
ATTTTGGTACAGCAGATAACCAAATAAACATATCTGGCTATTCTATCAATCAATATATGGGAAACATCTTGTATCAAGCACCAGAGAGCTTAGACCCAGCTGAACCATTCATAGGTAAGGTTTATCATGATGAATATTTAAAATTAGGTGTTAGTGTGAGACAAGAGCCAAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,301.0 L-21,604.3 L-33,963.2 S-02,078.7 S-33,025.8
S-64,361.9 S-92,160.6 S-124,304.7 S-153,423.7 S-244,005.4
C-05,475.3 C-21,466.8 C-42,404.9 C-6643.2 C-82,364.6
C-102,539.9 C-122,730.5 C-142,147.2 C-163,951.2 C-181,960.7