Summary
Transcript IDgene_000011691
Gene IDTTHERM_00900600
Length508 bp
Sequence
TAAGAACCTAAGTTAAAGCCTTATTAAGCTTCAATCTATTAGATTATGAAAAGCGAATTAACTAAAAAAGGCTACTCTGATTTTAGGTATTTAGGACAGGGATCATCAGGATTAGTTTTGTTAGCAAAAGATTCGAAAACCAACATGAGGTATGCCATCAAAGGTGTTTAAGTTAGAGATCCTCACGGAAATTTTGACTAAGATATTTACATTCAAGTGAAACGAGAAATAGAAATACTCAAAACATGTAGAGACTCTCCTTACGTAATCAGTCTTTTAGATTAATTTGAGGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCACCTAAATTATAGAAAGGAACAAAAACAAAAGACTGAATGAAATATCAGCAATCAAATACGCTAGTGATATTGCTCAAGGTCTCTACTACATTCACTCTAAGAGTTGCCTTTTAAATGATCTGAAAGCGGATAATATCTTAATTGACTATCATGGAAATGCAGTTCTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1495.1 L-2242.2 L-3953.7 S-0243.6 S-3503.5
S-6745.7 S-9418.4 S-121,081.4 S-15891.4 S-24814.1
C-0834.6 C-2218.6 C-4377.5 C-6157.2 C-8330.8
C-10346.7 C-12382.2 C-14335.4 C-16741.4 C-18453.3