Summary
Transcript IDgene_000011834
Gene IDTTHERM_00209270
Length529 bp
Sequence
ATAAAATTATGAAAGTAGCTTAAATAGGAGGTGGGTATACAGGAAAGTCATCTTTATATTTGAGATATCTTTAAGGAGAGTTTATTGACAACCCTAATTATATTGGCGTTGAATTTTATACAAAAACTATTAAGATAGCAGAGGAACAAATTAAATTTTAATTTTGGGATTGTCACTTGAACGAAAAAATCTATTCTTTATATCAAAATTATTTTAAATAATGTTCAATAGTTATGATATCTTATGACATTACTAATAGATACTCCTTTGATAGAGCGCAATTATGGTGTAAAGATTACAATTAAAAAAAATTAAATAAAGTAGCTCTACTAGCTTTGATTGGAAATAAATGCGATTTAGAATAATAAAGGTAAGTTTCATATCAAGAGGGTAAACATATTGCAAAGTCTTTAGGAATGCTATTCTTCGAAGTCTCCTCTAAAACAGGTTATTAAGTAAATGAGCTGTTTGAAAGTTTAATAAGCTACGTGATCAATATTAATTGAAATCCACATAGTATACACAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1309.6 L-2293.2 L-3210.5 S-0329.8 S-3168.0
S-6244.8 S-9200.4 S-12137.4 S-15229.2 S-24170.7
C-060.6 C-298.6 C-484.8 C-655.0 C-842.6
C-1034.4 C-1235.6 C-1455.9 C-1697.6 C-1875.9