Summary
Transcript IDgene_000011883
Gene IDTTHERM_00942680
Length955 bp
Sequence
TAAAAACCTAAAAAAGGGTTAATTAATTAGTAGAATGAACAATAATCCTCTCATTCCTAACAATCAAAAGACTTTGAAAGCAACGATTAAAAATTATAAAAAATTTTCTCATTTTTACAGTTTGCTATTACTCTTCATAGTTGCTACCACTTTTTATTCTTCAGATTAATTTATAAATATTGGCTATTTACCCTATCTCCAAGTGGCTATCATAACATTTTCATCTTGTACATTGGTATTTAACATATCCTCATTATTCTTCCTTCATAATTATGAAAAATATCCTAATAAATTGAATTCTTTCAATGTCCTAACAATTACCTCTTTAAGTGGTGTTTTTATATTAACCGCATCTAGTCTCCTCGCTTCTTATATGTATTCTTGTGGATCATGCTTTATTTCCATTTAAGGAGAGCTTAGTGGAAAAGATATTGTAGACAGTATCTCATGTAGTAATAATGGTTTTAGTGGATGTAATATTGGTAATGTATATAATATTGCAGCTGAATATGTCTAAGGTCTTTGTTAGTAAAGATAAAGTTGTTATACAGACAGTTTAACAGTATATAGTCGTGGTTACGCACTTGTACCTTAGTTAATTGCATGCATCGGAGCAGGATTTGTTAATTTTATGTACCTTTTGACATTTATATATTATAGAAGAGAACTAAAGGAATTTTAAATAATCCCTCTTAATTCTAATCAAGAAGACTTAAATTGATAATTTAGAAATAATTCTTTACCATAAAAAGTATAAGACAGAAGTAATACCAATTCTAATCAATAATATAATCAAAATATTTAATAAAACCCAAATGACGAATAGTAATAATAATAATAAGTGTTTAGTAACCAAATACTTAACAAAGTGCTCCTTAAGCAAACTATTAAGGTTACTCATATAATAGCGGTTATAATATACCTTAAGTAAATTATTAAGAAATTTTAAATCAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1717.5 L-21,124.5 L-32,784.3 S-0137.9 S-3362.1
S-6420.7 S-9335.8 S-12252.1 S-15180.8 S-24181.8
C-0495.9 C-2179.6 C-4161.4 C-61,641.9 C-8520.9
C-10491.1 C-12725.6 C-14888.8 C-16730.8 C-18719.7