Summary
Transcript IDgene_000011952
Gene IDTTHERM_00957580
Length1152 bp
Sequence
AAAAAAAAAATTAAATAATAGGAAAAACAAACTATAAAATTTTGCAAATAAATATCCTTAATTAAAAATCATATCAAATTTGCATTCAAATAATGTGTTTCGGATCCAGCTCTAAGAAATAGTAAAGCAAACCCAAGCTTTTAAAGCCCAAGCAAAGTTAGTACAAAACTAAGCTCATTCTTTTAGGTGACATGAACGTAGGCAAAACTTCAATCTGCGAGTATTACAAGAAGAACGTGCCTGCAAAGAACTTGCCAAATACAATTGGTGTCACATATTTCGAGTTCGACATCAAACTAGAAAATGGCATTAACGTTCACTTAGATATTTGGGATACAGCAGGATAAGAAATTTATTAGTCACTACTAAAGATATACTATCAAGATGCTAACATAGTTTTTTTAGTTTTTGATGTGAGTGCAAGATAGACTCTTGAACGTGTTGAGTACTGGATTAGCGAACTCAAAGAGCAAGTAGATGATAAAAACCTAAAGTTGGTGTTAATAGGTAACAAATGCGACATAGATGCAGATAAGAGGTAAATCAGTCTTGAGCAAGGTCAAGATTTTGCTAGAAATAAAAACATTCCTTACTTTGAAACTAGTGCAATCACTGGAGAAGGAATAGTTGAAGTATTCCGCTAAACAGTAAAGGACTATGTGTAATATAAGACAAACGGAGGAAAATGAATATAACAATTAATTAATCACTCATAAATAAAATTAAATCCTCAAAGCAAATGAATAATGCCATTTGCTTTTGGCATAATCAATTTCTCTTCTTTATTTCTTTCTTTCTTTCTAAGACTGACATAGTAAAATAAATAAACAAATAAATATATTTAAGCTACGACTAGATAAAAATTAATAAATGTAAAAATAATTAGAAAAATAGAATAGATTTATAAATAATAAAATAGCTTATAAGTAAATAAATAAATAAATAAATAAAAAAACAATAAATCAACTAAACAACAACAATAACAACCAACCAACCAAAATAACTTTTAAAATCTTTAAATTTATTTATCCTTTAATAAAAAATAATAAAAACAATTAAACAAATGTGAATTAAAATTGAATGAATAAATGAATGAATGATTTCTTTAGTCATATTTAACTTTATATTCTACTTGTTCTTCTTTTATAAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,732.5 L-21,441.4 L-31,189.5 S-01,551.6 S-31,321.3
S-61,636.8 S-91,936.4 S-121,786.3 S-152,030.7 S-241,748.1
C-0815.1 C-21,901.2 C-41,137.2 C-61,238.3 C-8843.4
C-10911.9 C-12688.2 C-14541.7 C-16519.6 C-18529.0