Summary
Transcript IDgene_000011979
Gene IDTTHERM_00974260
Length177 bp
Sequence
CAAAATACCATAATATAGCGGAGTATGTAGAAATTTAACAGAAGAATAGATCCAAAAGAAATTAAATGACAAAGTTGAATATTGCATAAGACTCAAAACTGATGAACTTACCAGAGACCCATATAAGAAGATATTTTATAAAGATGAAATATAGCTAAATCCTTTTATTTATCAAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,896.1 L-21,098.1 L-3577.2 S-0281.4 S-3145.1
S-6273.5 S-9420.6 S-12285.0 S-15161.8 S-24178.5
C-0731.8 C-2211.6 C-4119.3 C-6119.3 C-8148.5
C-10221.6 C-12246.6 C-14195.1 C-16166.6 C-18114.9