Summary
Transcript IDgene_000011980
Gene IDTTHERM_00974260
Length199 bp
Sequence
TCGGATCACCTAGATTTTAGAGATCTCTATACAGGGATATTAAAGTAGTGTATTAATTGGGACGAAGGATATCAAAATTAGTATGAAGAGGAGGGACAACTTGGTCCTTACGAAAGCTCTAAAAAATTAGATAGATATAAAGAAATTGCTGAATAACTGATAAAAGAAGGAAAAGCTTATAGATGCTTTTGTGATAAAG