Summary
Transcript IDgene_000012276
Gene IDTTHERM_00245410
Length1345 bp
Sequence
TATGTTTATCTGTTTGCCTTTTGATTAAAATTCGAAAAGACATTATTATTTTATTTTGTAAATATCAGAAAAGTAATTATAAAGCTAACTATAAATTTCTGAAAAAGATTAATTAAAATGAGTGACACAACAACAACAGCAAATTCAAAGAAAAACACCAAAATAAATGGTAAATAACAAGGTAGTAAAGATAAGGCTGAGAAGAAAGAGAAGGCTATTAACAAAAAGAAATATGAAAGCGAAGATGAAGAAGAAGAGGAAGAGGAGGAATTCTACATTGTAGAAAAAATATTAGATTATAAAAAGATAAAGAATAGAGATCTATTTTTAGTAAAATGGGAAGGGTACGAAGAGCTAACTTGGGAACCCAAATCTAATTTGTCAAATGTAAAGCAACTTGTTGAGAATTTTTTGAAAACCTTAAAAGATAAAGGAAAAAAAGAAAATTCTGAAAATCTTGAAAGCTCGAGTGCTTTGCAAGAAGGGAGTGAATCTAAAAAGCAATAATTAAGCGGTGGAAAGATATAAAAAAAAGAAGTAAAAAGCCCTATATCTATTAGCAAAGAGAAATAGGCAGAGAAAGTAAAGTAAGATGAAGGATCTCATTTAAAAAGAGATGTAGAAGATCACCATAATATTTCTATTTCTTCAATGAAGGGTAAAAAAGATGATGATGGAGAGTAGAATGAAGAACAAGAAAACAAAGTTGTTGTTAAATAAGAAGACGTAGATGAGGAAAAGCAAAGCACCAAGAAAAGAGGAGAAGAAGAAGAGGAATAGTAATAATAATAAAATAGTAAACAAATAGAGGAGGAAGAAGAAGGTAAAGATGTATAGAAAGAAAAGAAATAATAGAATGAAGAAAAATAAGATATCAAGCACTTAGAATAAAAAGAAAGTAAAGAAGACCACGATGCTATATAATAATAATAAAAGAACACTAGTCTCAATAAAAAAAGAAAGAAAGAAGAATAAAGTTAGGATGATATTGATGAATAAAATGAATAAGATAAACCACAAGATAAGGTAAAACACTTACCTGAAATTTTAGGAAATCTTGAAGAACACATTCCTTTAGAAATATCTAAAGCTGTCTATAAAACATCTAAGTTTTAGTATCTAGTTTAGTGGAAGTAGCAATAAGGCATTAAAATTATACCCAGTTTTATTTTCTCTGACGATTTATTAAAAAGATATAGTGATCTCATAGTACATTTTTATGAAGACAAAGCCTTAAAAAGAAAGTGATTAAAATCTAATATCAATTTTTAATAAAAATTTAGTTTGATTTAAATATCCTCTATATAAATATTGTTTTTAATTAAATTAACTTATTATAAAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,306.5 L-21,250.8 L-31,137.6 S-0457.1 S-3684.4
S-6778.3 S-9778.5 S-12766.9 S-15714.9 S-24659.1
C-0294.9 C-21,829.5 C-43,151.6 C-63,758.4 C-82,800.7
C-101,171.9 C-121,169.7 C-141,637.3 C-161,184.7 C-18834.4