Summary
Transcript IDgene_000012285
Gene IDTTHERM_00245660
Length2155 bp
Sequence
ATTAGAAACTAATACTCAACATAGATATTTCACAAAAGTAGATATAATAAAAAAGGTTAGCAACTTTATTTTAAAAATATTAAGTTTAAAAAATTAAAAGATTAACTGTTAATAGATCTAAATGATGGTTAGGCAATAAAATAACTAGAATACACAGAGTTAAAGCAATATCACAACCAGTGTTAGTCAATATACATCAGAAGATTCCTAAAATTCTTAGGTTCAAAGAGAAAACAGGAATAAAATAATCTTAAAGTATGATGAAAACATTGCCAAAATAGTTGCTTTGGGCATGGAAGAAAAGCTCATAAAAAATTAATTGGGAAAAATAGATATATCAGATGCACTTGTCAAAGTGAGTAGTAATGTTAACATTTTTAGTGTTAAGTAGAGTGCTAATTTTTTGTTTGCAATATCTAAATTGATAAATTATGGATATCTCTCGCTAAATTAGGAATTAAAAGATTTCTTTGCAAGATTTAAAGATTAGATTATGAAGTAGTAGTAGCAGTAATAGTAAAAAGAAAAGTAACATAGATCTAGCAGAAAAAATTAGACTAAAAAAAGACTCAGAGACGCAGCAAAGGAGATAGCTGATAACTTAAGCAACAGCATTGATGAAAGATCTAACACTTCTATTTAGTAACCTAGACATATTTCTACAGAAGAGAGACTGAATATGCAAGAATAGAATCTGATATCACCTCTCGCTATGATGATTAATTAAAGATCTGATTTAGATTCAGATAATGAAAATTCAAATACAGGTTTTAGCGATAATTTACCTGATCCTAATTAACAAAGACTTATGATGCTTGGAGAGGATAATTTAGCTGGGATAGAATTTGATGGGGGACTTGGCATGGATACAGGTTTTGATTATGATGGATTTTAGTATGATTTTAGTGAACAAGATAGTTAAAGCTAAGGATTCAATAAGGTTAATGGAAATGCTATAAATATCTCCCAAGAATTAAATTAAGTTGGCGACATCTCTGAAAGATATATAAGAAAAATTACCAATTATGCCAATTAACAATCTTCAAAAAAGAAAAAAAAAACTAAACAAAAATAATAGGGACATAACAAAGAAGGCGAGCATGCAATTCTTAATGAAACAGTAGATATGGATAATTAAGAGTTTTCAAAAGCTATGGATGAAAAATTAAATTAGTTCTATAGTAGCTAATCATAAAGAGTTAATAAAAATATATCACATATTTCAGATATATCTAGATTATCGACCACATTATAATAGCCATCAATATTATCACAAAATTTTAATATCTATGAAGAATCAATCAGCGAAGCACCTTTCTAATAAATTAATATATCGAATTATTTAAATGCTTCCACCCTAGTTGACTAACCAATTTTGAATCTTACTAAGAAATTTGATGAAGCAATAAGCCTAAAAGAAAATGATAATAATGTGCTCCTTTCTGAAGAACTTATTTCTAAATTAGAAAAAGCAATGCAAAATATAAATATTGATTTAGTAAAATAAGACTAAGGTGGAGTGGATATGATGGATTTTAACTAGGATAACTAAGGCGGCTACATGGATTATCCTGATGATTTTGGTAGCTTAGATTAATATAATCAATAAAAAGAAGAATAAGATGGAGAACTAGAAATTCCTGTTCAAATACCAGAAATATAAAAATCTAAGCTAGAAAAAGATAAAAAAATTGATGAAATTGATAGTTTATAAGACTTTGATATTACTCCTCTTGATAAAAAAATTCTTACAGAAGAGGAATAAAGAGTTCTTCAGTAATATGACAAATTATTCACAAAATTAAGAGATATCCTAGACAAAGAACCAACTGCTGAGTTTAACGATGTTTATTAATCATTCAAAAACTAAAAGAGTAAAGCAGAGCTCTTCTACGATATTTTGGAGTTATAAAAGCTTGGTCAGATTTCTGTTTCTTAAAACGATAATATTCATTTTTCACCAATACAAATTCTTATCAAATGAGAATTTCTATATATATTTTGACTATTATTTAATAGTTAACTACAAACCTAACTAATATTTATTCTAAATTTTAATGGAGTTAAATAAATTAACATTTTCTAATACATATTCTGTAAAAAATTAATATGTTTCCTGTTTAAGATAGCTATGGCTTAGATTCACATATAATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,183.2 L-21,035.2 L-31,266.9 S-0379.2 S-3839.0
S-6397.0 S-9333.0 S-12294.8 S-15366.0 S-24356.5
C-0244.6 C-218,942.1 C-411,409.9 C-630,575.2 C-812,521.5
C-107,058.2 C-127,320.0 C-145,172.2 C-165,691.5 C-182,260.2