Summary
Transcript IDgene_000012675
Gene IDTTHERM_01166310
Length644 bp
Sequence
TAGAAAGTAGAAAGATAAAAGGAATAGTTTAGAAAGCAAAATTTAGTAAAACAAATGCTAATTAAAAAGTTAGGAAGGGCGATATTCGATTTTAAATGTTATGGGCTGACATTAATAAATTATAAAAAGGGAACTAAGAGTTTCATGAGTTTAGAAAATAATTACAGAGATATTTAATTTGATGATATAGTTAATAATTTAGGAGAAAGCCACAAGGAGTTGGCATAAAAATTCAAGGAAGCAGCGAAATTTTCTAATTTAACTGAGCTAAATGATGGACAAATAAAGATTATACTTGAAAACTATAAAAAAGAGACAGGAGAAGTAGCAATTGATTCTAAAACAGTAAATAAGAAAGAAAATCACTTTAAAATGTTCTACAATCTTGTATAACTTGTAGAAAGAGATATCACTCTTCTTGTGGCTAATTAATATTTTAAAGATTTAGAAATCACGAATGGATAGAGTTTTAAAGGAGCCAGAATTTTGTAAGGTAAAGCAAGCTCAGGAGTAAAGGCATTGAGATACGCAAAGGAAATAGATCCATCGTATATCCAAGATATAACAGTAATTGAAAAAGATATTAACTTCCCTGAATACTTCAAGTTATTAGCTCATTACAATGATATTGACATGTCTAAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,889.3 L-21,819.9 L-31,107.7 S-0221.8 S-374.5
S-686.0 S-951.7 S-12127.9 S-15212.9 S-24123.7
C-0298.6 C-250.6 C-4116.9 C-6210.7 C-8155.5
C-10387.7 C-12200.6 C-14186.1 C-16124.5 C-18182.8