Summary
Transcript IDgene_000012676
Gene IDTTHERM_01166310
Length712 bp
Sequence
AGAAAGTAGAAAGCTAATAAGAGTAATTTAGAAAGCGAAATTTAGTAATGCAAATGCTGATTAAAAAGTTAAGAAAAGCCATATTTGATTTTAAATGTTATGGACTGACATTAATTAATTATAAAAAAGGATTTAAGAGTTTCATAACTTTAGAGAATATTTTATTCGATGATACTGTAAACAATTTAGGAGAAAAACACAAGGGAGTTGGTATAAAAATGATAGGAAGCAGCAAAAATCCTCTAATTTAGCTAAGCTAAATGATGAATAAATGAAGATTATACTTGAAAGATATAAAAAAGAGACAGTAGAAGTAACAATTTATTAGAAAACATTTAACAAGAAAGAAAATCACTCAAAAATATTCTACAATCTTTTATAAATCGTAGAATGAATATAACTCTTCTTGCGTCTAATTAATACTTCAAAGATTTAGAAATCACAAGAAAATGTTAGAATTCTAAAGGAAGGAGCCAAAATTTTGTAAAAGGCAAATCAAGATCAGTGATAAAGAGATTGAGATACATAAAATAAATAGATCCATCATATATCAAAGATATAACAGTAATTGAAAAAAATATTAACTTCCCTAAATACCTCAAGTTATTAGCTCATTACAATGATATTGAAATATATAAATTTAAATTTAAAAGTAAAATAAATTGATTTTATTATTAGCTAAACAATAAAATTTTAATATTTTTGATAGTAG